This page allows you to curate the loaded statements. For more information please see the manual.

Statements

databases
phosphosite cbn pc11 biopax bel_lc signor biogrid lincs_drug tas hprd trrust ctd virhostnet phosphoelm drugbank omnipath | geneways tees isi trips rlimsp medscan sparser eidos reach
reading

SCN5A affects sodium atom
| 1 55
SCN5A activates sodium atom.
| 27
| 20
reach
"The SCN5A gene directs synthesis of cardiac-type, voltage dependent, Na + channels (Na v 1.5), abundant in the heart."
reach
"Mutations in the SCN5A gene associated with LQTS typically cause a gain-of-function phenotype resulting in enhanced Na + entry into the cardiomyocyte during the repolarization period 2."
reach
"How does nitrosylation of SCN5A cause increased late I Na?"
reach
"Few months after its identification as a LQTS gene in 1995, it was shown that the SCN5A DeltaKPQ mutation produces the LQTS phenotype by increasing the persistent (or late) Na + inward current and, therefore, prolonging action potential duration."
reach
"The Ala 390 --> Val mutation in alpha-syntrophin alters the inhibitory interaction between nNOS and the plasma membrane Ca-ATPase, and the resultant S nitrosylation of the Na + channel SCN5A enhances Na + influx XREF_BIBR, a pro arrhythmic event recapitulating long-QT syndrome."
reach
"Co-expression of SCN5A-E1784K and SCN5A-WT reduced I Na, P to 70.03% of WT, shifted steady-state inactivation by -11.03 mV, and increased I Na, L from 0.14% to 1.86% of I Na, P."
reach
"Loss of function mutations in SCN5A leads to reduced I Na during the AP, causing a reduction in the doming of the AP."
reach
"It was previously shown that overexpression of SCN1B and SCN5A, the alpha-subunit of Na v 1.5, increased Na v 1.5 current amplitude and the late sodium current, I NaL XREF_BIBR."
reach
"LQT3 is a repolarization disorder caused by gain-of-function mutations in SCN5A encoding the cardiac Na + channel."
reach
"Plant etal32 previously reported that sleep respiratory abnormality associated intracellular acidosis significantly increased the late I Na caused by the sudden infant death syndrome susceptibility SCN5A common variant, S1103Y, in blacks."
reach
"XREF_BIBR Since a synonymous nucleotide change in the SCN5A gene is unlikely to induce a functional change in the Na + channel, a non synonymous substitution was considered as a candidate for the variation associated with this disorder."
reach
"Many of the SCN5A variants associated with DCM reduce I Na density or exhibit rate dependent reductions of Na + current (12,24-26)."
reach
"Brugada syndrome (BS) is an inherited cardiac disorder associated with a high risk of sudden cardiac death and is caused by mutations in the SCN5A gene encoding the cardiac sodium channel alpha-subunit (Na (v) 1.5)."
reach
"Moreover, CPVT was recently linked to a gain-of-function mutation in Scn5a that increased Na + influx by augmenting the Na + channel window current."
reach
"Long QT syndrome type 3 (LQT3) is associated with genetic modifications of the Scn5a gene, which interfere with Na + channel inactivation and lead to persistent, arrhythmogenic late Na + currents."
reach
"It has been reported that cardiac specific overexpression of the SCN5a gene did not significantly increase the surface density of the Na + channels in ventricular myocytes, indicating that Na V 1.5 localization to the membrane and formation of functional channels are limited [XREF_BIBR]."
reach
"A ground breaking in-vitro expression study by Bennett et al in September 1995 showed that the SCN5A DeltaKPQ mutation produces the LQTS phenotype by increasing the delayed Na + inward current and therefore prolonging the action potential duration."
reach
"In the specific case of the S1103Y variant of SCN5A, which has been shown to increase the " late " or sustained Na + current 16, consideration of the use of agents such as ranolazine that diminish the sustained current to reduce arrhythmic events is worthy of speculation."
reach
"Mutations in SCN5A that pathologically increase late I Na may influence repolarization and refractoriness."
reach
"Targeting SCN5A expression using specific siRNA completely abolished the presence of I Na and had the same effect as TTX for reducing cancer cell invasiveness."
Mutated SCN5A activates sodium atom. 7 / 7
| 7
reach
"In this context it is notable that LQT3 syndrome has been associated with familial atrial fibrillation (AF) [XREF_BIBR - XREF_BIBR], and a large proportion of SCN5A mutations found in young patients with lone AF actually increased I Na, late [XREF_BIBR]."
reach
"SCN5A mutations lead to gain of function of Na + channel activity."
reach
"In summary, the phenotypic characterization of this mouse model has demonstrated that a single SCN5A mutation is sufficient to cause an overlap syndrome of cardiac Na + channel diseases."
reach
"Enhanced late I Na caused by the mutation of SCN5A was initially reported to be contributed to arrhythmias in patients with LQTs 3."
reach
"The SCN5A mutations underlying MEPPC are typically gain-of-function mutations due to an increased window I Na, faster recovery from inactivation and/or increased channel availability of Na V 1.5 (see, and primary references cited therein)."
reach
"Hereditary PCCD has been attributed to loss-of-function SCN5A mutations that reduce Na + current by decreasing sarcolemmal expression of channel proteins, causing an expression of non functional channels, or altering channel gating properties through delayed activation, earlier inactivation, enhanced slow inactivation, or slowed recovery from inactivation."
reach
"Na + influx can be increased several-fold when late I Na is enhanced by ischemia, lysophosphatidylcholine, H 2 O 2, or SCN5A mutations thus increasing the incidence of DADs."
SCN5A inhibits sodium atom.
| 26
| 21
reach
"As expected, Scn5a +/- hearts had significantly reduced Na v 1.5 expression, but there was a further difference between LV and RV, with approximately 30 per cent reduction in the LV and approximately 50 per cent reduction in the RV when compared with WT, resulting in a significantly lower expression of Na v 1.5 in the RV compared with the LV of Scn5a +/- hearts."
reach
"Direct and Indirect Suppression of Scn5a Gene Expression Mediates Cardiac Na"
reach
"Na + channel activity and invasive potential were inhibited pharmacologically by tetrodotoxin or genetically by siRNAs specifically targeting SCN5A."
reach
"It is well established that mutations in SCN5A, the a-subunit of the cardiac Na + channel, reduce the magnitude of the cardiac Na + current by a variety of mechanisms [XREF_BIBR] and are linked to the development BrS [XREF_BIBR]."
reach
"Mutations in SCN5A leading to LQTS3 produce gain-of-function defects by disrupting Na + channel inactivation, thereby causing a small persistent I Na during the action potential plateau XREF_BIBR XREF_BIBR."
reach
"Mutations in SCN5A as well as SCN1B or SCN3B, both encoding auxiliary beta-subunits, all reduced Na + currents."
reach
"Patch clamp analyses of Scn5a +/- SA node cells demonstrated similar steady-state activation and inactivation properties but reduced maximum Na + currents (~ 30%) compared to WT."
reach
"In addition, a common polymorphism (H558R) in SCN5A, present in 20% of the population (20), reduces Na + current density (21)."
reach
"Genetic lesions in SCN5A can cause congenital long QT syndrome (LQTS) variant 3 (LQT-3) in adults by disrupting inactivation of the Na v 1.5 channel."
reach
"Mutations in SCN5A can disrupt proper function of Na V 1.5 and as such lead to different, mainly cardiac, diseases."
reach
"XREF_BIBR, XREF_BIBR Moreover, a mutation in a single allele of SCN5A mimicking a variant causes an 86% reduction in Na + current, greater than the 50% predicted reduction."
reach
"115 In a subsequent study, co-expression of mutant SCN1B with WT-SCN5A and WT-KCND3 (separately) induced a 55.6% decrease in peak I Na and 70.6% gain of function in I to, moreover, co-immunoprecipitation revealed structural association between Na V beta1B, Na V 1.5 and K V 4.3, suggesting that the elevated level of transient outward potassium current is predominantly responsible for pathogenesis in these cases of BrS."
reach
"Co-expression of SCN5A-E1784K and SCN5A-WT reduced I Na, P to 70.03% of WT, shifted steady-state inactivation by -11.03 mV, and increased I Na, L from 0.14% to 1.86% of I Na, P."
reach
"RBM25 and LUC7L3 mediated abnormal SCN5A mRNA splicing reduces Na + channel current to a range known to cause sudden cardiac death [XREF_BIBR]."
reach
"Mutations in SCN5A are known to reduce Na + current by a variety of mechanisms, leading to the development of BrS."
reach
"A human SCN5A BrS variant eliminates Na v 1.5-ankyrin-G interactions."
reach
"Irritable bowel syndrome patients have SCN5A channelopathies that lead to decreased Na"
reach
"Na v 1.5 transcripts were similarly down-regulated by almost 50% in Scn5a +/- mice with both mild and severe phenotype, showing that the phenotype heterogeneity was not due to differential transcription of the WT Scn5a allele."
reach
"Many of the SCN5A variants associated with DCM reduce I Na density or exhibit rate dependent reductions of Na + current (12,24-26)."
reach
"We considered that F1486del mutation in SCN5A is critical to inactivate Na v 1.5."
reach
"Multiple mutations of genes, SCN5A, SCN1B, SCN3B, GPD1L, CACNA1C, CACNB2, KCNE3 and KCND3, have been shown to decrease cardiac Na + and Ca 2+ channel activity or increase fast transient outward K + channel activity, and they are linked to BrS."
Mutated SCN5A inhibits sodium atom. 2 / 2
| 2
reach
"However, some SCN5A mutations impair mexiletine effects and the drug may favor Na channel trafficking to the membrane, thus raising concerns about the indiscriminate use of sodium channel blockers in LQT3 without careful individual testing."
reach
"SCN5A mutations may reduce I Na by changing the functional properties (gating) of the sodium channel protein 16 or by resulting in its failure to express in the sarcolemma (trafficking)."
SCN5A bound to RBM25 inhibits sodium atom. 1 / 1
| 1
reach
"Our results shows that AngII and hypoxia, signals common to HF, result in increased LUC7L3 and RBM25 splicing regulators, increased binding of RBM25 to SCN5A mRNA, increased SCN5A splice variant abundances, decreased full-length SCN5A mRNA and protein, and decreased Na + current."
SCN5A-F1473C inhibits sodium atom. 1 / 1
| 1
reach
"The results of our study clearly show that the SCN5A F1473C mutation, which was discovered as a de novo mutation in a newborn, clearly disrupts inactivation of Na v 1.5 channels in manners which contribute to delayed repolarization in cardiac cells expressing this channel variant."
SCN5A-D1790G inhibits sodium atom. 1 / 1
| 1
reach
"Indeed, the SCN5A D1790G long QT mutation disrupts the ability of Na v 1.5 to be modulated by beta1 [40]."
SCN5A increases the amount of sodium atom.
| 2
Modified SCN5A increases the amount of sodium atom. 1 / 1
| 1
reach
"The decreased PM expression of Na v 1.5 was not caused by decreased SCN5A gene expression since the total amounts of SCN5A mRNA and Na v 1.5 protein did not decrease significantly in the cells (XREF_FIG)."
SCN5A increases the amount of sodium atom. 1 / 1
| 1
reach
"Loss-of-function mutations in SCN5A lead to lower expression levels of SCN5A or production of defective Na v 1.5 proteins and cause Brugada syndrome, an electrical disease with minor structural changes in the heart."
| 1
sparser
"Mutations in the genes KCNQ1 , KCNH2 , KCNE1 and KCNE2 encoding cardiac K + channel subunits and the SCN5A gene encoding a Na + channel subunit are associated with long QT syndrome (LQTS), a life-threatening arrhythmogenic disorder characterized by prolongation of the QT interval on electrocardiograms [2] ."
SCN5A affects sodium(1+)
1 | 46
SCN5A activates sodium(1+).
| 26
| 18
reach
"Mutations in SCN5A may cause sodium channel dysfunction by decreasing peak sodium current, which slows conduction and facilitates reentry based arrhythmias, and by enhancing late sodium current, which prolongs the action potential and sets the stage for early afterdepolarization and arrhythmias."
reach
"The genetic type 3 of this syndrome (LQT3) is caused by gain-of-function mutations in the SCN5A cardiac sodium channel gene which mediates the fast Na v 1.5 current during action potential initiation."
reach
"In addition, sodium channel dysfunction caused by mutations in the SCN5A gene, encoding the major sodium channel in heart, is associated with a number of arrhythmia syndromes."
reach
"Brugada syndrome is an inherited cardiac disorder caused by mutations in the SCN5A gene encoding the cardiac sodium channel alpha subunit, which can lead ventricular fibrillation and sudden death."
reach
"Class I antiarrhythmic agents such as flecainide, lidocaine and mexiletine generally block I (NA (P)) more potently than block of I (Na (T)) and have been used clinically to treat LQT3 syndrome, which arises because mutations in SCN5A produce defective inactivation of the cardiac sodium channel."
reach
"Mutations in KCNQ1 (LQT1) and HERG (LQT2) cause defects in the delayed rectifier potassium currents, [XREF_BIBR XREF_BIBR] whereas mutations in SCN5A (LQT3) cause a persistent cardiac sodium current."
reach
"Since a synonymous nucleotide change in the SCN5A gene is unlikely to induce the functional change of the sodium channel, a non synonymous substitution was considered as a candidate for the mutation associated with this disorder."
reach
"Since a non synonymous nucleotide change in the SCN5A gene is likely to induce a functional change in the sodium channel, a non synonymous substitution was considered a candidate for the variation associated with this disorder."
reach
"As compared to the expression of SCN5A alone, coexpression of both SCN5A and VCL can increase sodium current density by = ~ 30% but did not change the sodium channel 's activation and inactivation properties."
reach
"In addition, sodium channel dysfunction caused by mutations in the SCN5A gene, encoding the major sodium channel in heart, is associated with a number of relatively uncommon arrhythmia syndromes, including long-QT syndrome type 3 (LQT3), Brugada syndrome, conduction disease, sinus node dysfunction, and atrial standstill, which potentially lead to fatal arrhythmias in otherwise healthy young individuals (Tan et al. 2003)."
reach
"In approximately 20% of the cases BrS is caused by mutations in the SCN5A gene on chromosome 3p21-23, encoding the cardiac sodium channel, a protein involved in the control of myocardial excitability."
reach
"Brugada syndrome (BS) is an inherited cardiac disorder associated with a high risk of sudden cardiac death and is caused by mutations in the SCN5A gene encoding the cardiac sodium channel alpha-subunit (Na (v) 1.5)."
reach
"Cardiac sodium channel dysfunction caused by mutations in the SCN5A gene is associated with a number of relatively uncommon arrhythmia syndromes, including long-QT syndrome type 3 (LQT3), Brugada syndrome, conduction disease, sinus node dysfunction, and atrial standstill, which potentially lead to fatal arrhythmias in relatively young individuals."
reach
"175 SQTL3 accounts for approximately 10% of all mutations diagnosed in LQTS, due to changes in the SCN5A gene, whose functional gain produces a continuous sodium input during the plateau phase, which facilitates early depolarization in cardiac cells."
reach
"Mutations in SCN5A have also been shown to cause the sodium channel to turn off prematurely and thus to set the stage for the development of a rapid polymorphic ventricular tachycardia and ventricular fibrillation in patients with the Brugada Syndrome."
reach
"Possible explanations for our case are : (1) the proband but not his father carries unidentified BrS susceptibility gene (s), and/or (2) the father but not the proband carries unknown genetic variant (s) that can rescue or mitigate the BrS phenotype and restore the sodium channel dysfunctions caused by SCN5A gene defects."
reach
"A390V-SNTA1 expressed with SCN5A, nNOS, and PMCA4b in heterologous cells increased peak and late sodium current compared with WT-SNTA1, and the increase was partially inhibited by NOS blockers."
reach
"In contrast we did find a significant increase in expression (~ 2 fold) in Galpha i2 (-/-) mice of the calcium channel alpha subunit, CACNA1C (Ca v 1.2), which underlies the L-type calcium current and SCN5A which underlies the rapidly inactivating sodium current in ventricular myocytes (XREF_TABLE)."
Mutated SCN5A activates sodium(1+). 6 / 6
| 6
reach
"In contrast, loss of function SCN5A mutations underlying Brugada syndrome and conduction disease were reported to reduce the total amount of available sodium current, either owing to impaired intracellular trafficking and decreased membrane surface channel expression, or through altered channel gating properties including disruption of activation, accelerated inactivation, and impaired recovery from inactivation (see Tan et al. 2003)."
reach
"By contrast, SCN5A mutations probably cause subtle alterations of cardiac sodium channel function and prolonged depolarizing currents."
reach
"Our study supports the concept that febrile illness predisposes individuals who carry a loss of function SCN5A mutation, such as V1340I, to fever induced ventricular arrhythmias in BrS by significantly reducing the sodium currents in the hyperthermic state."
reach
"The T1620M SCN5A mutant was shown to recover more rapidly than wild-type channels [13], in contradistinction to SCN5A mutations responsible for LQT3, which typically cause a persistent noninactivating sodium current as the major phenotypic change [7-9]."
reach
"Importantly, one single SCN5A mutation may cause several changes in the expression and/or gating properties of the resulting sodium channels."
reach
"As " gain-of-function " SCN5A mutations induce an excess of sodium entering into the cells, sodium channel blockade represents a rational approach for gene specific therapy in LQT3."
SCN5A-R222Q activates sodium(1+). 1 / 1
| 1
reach
"While SCN5A R222Q increases plateau inward sodium current, action potentials were unexpectedly shortened likely reflecting an outward gating-pore current."
SCN5A-R1193Q activates sodium(1+). 1 / 1
| 1
reach
"The common SCN5A mutation R1193Q causes LQTS-type electrophysiological alterations of the cardiac sodium channel."
SCN5A inhibits sodium(1+).
| 19
| 10
reach
"Perspectives COMPETENCY IN MEDICAL KNOWLEDGE : BrS is commonly associated with genetic variants in SCN5A that reduce inward sodium current and promote single-cell proarrhythmic activity."
reach
"The HERG mediated potassium and the SCN5A mediated sodium currents, however, were only slightly reduced by estradiol at concentrations of up to 30 microM."
reach
"Deficient SCN5A gene mutation could decrease the function of sodium channel, decrease the I Na at depolarization and depolarization velocity and peak value of cardiomyocytes during depolarization, and block the cardiac conduction system in varying degrees, eventually leading to the occurrence of AVB [XREF_BIBR]."
reach
"Mutations in SCN5A may cause sodium channel dysfunction by decreasing peak sodium current, which slows conduction and facilitates reentry based arrhythmias, and by enhancing late sodium current, which prolongs the action potential and sets the stage for early afterdepolarization and arrhythmias."
reach
"We report identification and characterization of a rare loss-of-Function (LoF) variant in the SCN5A gene that impaired sodium current density and was associated with incessant and lethal ventricular tachycardia and fibrillation (VT/VF) after administration of lidocaine to a patient with acute myocardial infarction (AMI)."
reach
"Variants in SCN5A have been shown to impair the sodium ion channel and associated with dilated cardiomyopathy with and without conduction disease, Brugada syndrome, and other arrhythmias."
reach
"XREF_BIBR SCN5A causes slow recovery of the sodium channels from an inactive state, which contributes to a conduction delay at the ventricular level."
reach
"For example, Itoh et al. reported that the SCN5A variant p.N406S identified in Brugada Syndrome patients enhanced use dependent block of sodium currents with quinidine, a class IA antiarrythmic agent, but the same variant abolished the block with pilsicainide [XREF_BIBR]."
reach
"Specially, the cardiac sodium channel (SCN5A) mutations that reduce peak sodium current (such as mutations linked to Brugada syndrome) and QTc prolongation in patients with LQT3, or overlap syndrome."
reach
"In the Brugada syndrome, mutations in SCN5A reduce sodium current density, causing premature repolarization of the epicardial action potential due to an all or none repolarization at the end of phase 1."
Mutated SCN5A inhibits sodium(1+). 8 / 8
| 8
reach
"SCN5A mutations may reduce I Na by changing the functional properties (gating) of the sodium channel protein 16 or by resulting in its failure to express in the sarcolemma (trafficking)."
reach
"In contrast, Brugada and conduction disease SCN5A mutations diminish sodium current, resulting in a ' loss of function ' [XREF_BIBR]."
reach
"Although many SCN5A mutations reduce sodium current densities by more than 80%, some of them decrease peak currents by only ~ 15% (e.g., L567Q and R1023H) [XREF_BIBR, XREF_BIBR]."
reach
"Electrophysiological studies using cell expression systems and animal models demonstrated that the attenuated sodium channel function caused by these SCN5A mutations can result in the loss of the action potential (AP) dome, thereby exaggerating the transmural repolarization gradient [XREF_BIBR]."
reach
"Functional analyses have revealed that most SCN5A mutations lead to a loss of function of cardiac sodium channels by reducing the sodium current (I Na) available during the early phase of the cardiac action potential (Balser, 1999; Baroudi et al., 2000)."
reach
"Loss-of-function sodium channelopathies are autosomal dominant inherited conditions in which SCN5A mutations produce sodium channels that conduct less sodium current (I Na)."
reach
"Accordingly, experimental studies suggest that BrS linked SCN5A mutations reduce sodium current more at fast heart rates."
reach
"Cardiac sodium current reduction caused by SCN5A mutations may facilitate AFib by slowing intra-atrial conduction and inducing structural changes, but also prevent it by suppressing atrial ectopic activity."
SCN5A-F1473S inhibits sodium(1+). 1 / 1
| 1
reach
"This study was designed to test the allitridum (All) activity in correction of sodium current decrease caused by SCN5A F1473S mutation in HEK293 cells."
SCN5A increases the amount of sodium(1+).
1 |
SCN5A increases the amount of sodium(1+). 1 / 1
1 |
signor
"Voltage-gated Na1 channels (NaV channels) drive the rapid upstroke of action potentials in cardiac and skeletal muscle and in most neurons, thereby serving as initiators of electrical activity in excitable tissue. Nine genes encode a family of homologous of NaV channel pore-forming a subunits. While channels are open, Na1 ions flux through the central pore down an electrochemical gradient, further depolarizing the membrane and triggering an action potential."
SCN5A binds sodium(1+).
| 1
Sodium(1+) binds SCN5A-S1103Y. 1 / 1
| 1
reach
"A common cardiac sodium channel variant associated with sudden infant death in African Americans, SCN5A S1103Y."
SCN5A affects VCL
| 12 12
SCN5A binds VCL.
| 12 9
| 12 9
reach
"Interestingly, we found the interaction between VCL and SCN5A were not affected by the M94I mutation of VCL (XREF_FIG, D)."
sparser
"Interestingly, we found the interaction between VCL and SCN5A were not affected by the M94I mutation of VCL ( xref ,D)."
reach
"According to our findings that VCL directly interacts with SCN5A invivo and invitro and that VCL and SCN5A were colocalized at the ID in the human heart, this functional effect may result from the direct association between VCL and SCN5A.17 However, the fact that VCL-D841H did not affect the interaction between VCL and SCN5A suggested that the molecular mechanism for this functional interaction remains to be addressed."
sparser
"Vinculin Physically and Functionally Interacts With SCN5A."
reach
"In this study, we initially identified that VCL interacts directly with SCN5A in both mouse heart and HEK293 cells transiently expressing VCL and SCN5A."
reach
"Co-immunoprecipitation also showed that VCL-M94I did n't affect the physical interaction between VCL and SCN5A."
reach
"Through biophysical investigation, we have now linked a VCL variant M94I to the loss-of-function of cardiac sodium channel in both HEK293 cells and iPSC-CMs, showing a previously unknown functional interaction between VCL and SCN5A."
sparser
"VCL was also confirmed to directly interact with SCN5A, and VCL-D841H did not disrupt the association of VCL and SCN5A. A VCL common variant was genetically and biophysically associated with Chinese SUNDS."
reach
"The interaction between VCL and SCN5A were also observed in HEK293 cells overexpressing VCL and SCN5A (XREF_FIG), further confirming their direct interaction."
reach
"To explore the relationship between VCL and SCN5A, we used co-immunoprecipitation experiments to examine if VCL physically interacts with SCN5A."
sparser
"These results suggest that VCL-M94I doesn’t disrupt the physical association of VCL and SCN5A."
sparser
"Co-immunoprecipitation also showed that VCL-M94I didn’t affect the physical interaction between VCL and SCN5A. These results suggest the observed functional effect of mutant VCL-M94I on SCN5A does not involve expression and distribution of VCL or SCN5A. The precise mechanism for decreased I Na observed ( xref and xref ) is unclear."
sparser
"As previously reported, xref we identified that VCL directly interacts with SCN5A in vivo and in vitro using coimmunoprecipitations (Figure  xref A and xref B)."
sparser
"More detailed biophysical mechanisms for the alteration of sodium channel kinetics and the functional interaction of VCL with SCN5A remain to be identified."
reach
"VCL directly interacts with SCN5A in vivo and in vitro."
sparser
"In this study, we initially identified that VCL interacts directly with SCN5A in both mouse heart and HEK293 cells transiently expressing VCL and SCN5A. Based on these studies, we speculated that dysfunction of VCL may affect sodium channel function."
sparser
"VCL directly interacts with SCN5A in vivo and in vitro ."
sparser
"Through biophysical investigation, we have now linked a VCL variant M94I to the loss-of-function of cardiac sodium channel in both HEK293 cells and iPSC-CMs, showing a previously unknown functional interaction between VCL and SCN5A. In the myocardial section from the VCL-M94I carrier, we confirmed the co-localization of VCL and SCN5A at ID, but didn’t find significant difference in distribution of both VCL and SCN5A compared to control."
sparser
"The interaction between VCL and SCN5A were also observed in HEK293 cells overexpressing VCL and SCN5A ( xref ), further confirming their direct interaction."
sparser
"To explore the relationship between VCL and SCN5A, we used co-immunoprecipitation experiments to examine if VCL physically interacts with SCN5A. In mouse heart tissues, immunoblot analysis of immunoprecipitated VCL detected the presence of SCN5A, and we also found VCL present following a reciprocal immunoprecipitate using the antibody against SCN5A; due to the negative expression of SCN5A, mouse liver tissue was used as a control ( xref )."
reach
"Furthermore, VCL-D841H does not affect this physical association between VCL and SCN5A."
SCN5A activates VCL.
| 2
SCN5A activates VCL. 1 / 1
| 1
reach
"HH1 activates at potentials 7 mV more hyperpolarized than does rSkM1, with V a = - 21.8 +/- 2.6 mV (n = 8) and - 28.6 +/- 1.8 mV (n = 7) for rSkM1 and hH1, respectively."
SCN5A bound to VCL activates VCL. 1 / 1
| 1
reach
"The interaction between VCL and SCN5A were also observed in HEK293 cells overexpressing VCL and SCN5A (XREF_FIG), further confirming their direct interaction."
SCN5A inhibits VCL.
| 1
SCN5A inhibits VCL. 1 / 1
| 1
reach
"Fig. 2 B shows the h inf curve for rSkM1 versus hH1 and indicates that hH1 inactivates at potentials 10 mV more hyperpolarized than rSkM1, with V i = -59.4 +/- 3.2 mV (n = 10) and -69.4 +/- 2.9 mV (n = 7) for rSkM1 and hH1, respectively."
VCL affects SCN5A
| 12 10
VCL binds SCN5A.
| 12 9
| 12 9
reach
"Interestingly, we found the interaction between VCL and SCN5A were not affected by the M94I mutation of VCL (XREF_FIG, D)."
sparser
"Interestingly, we found the interaction between VCL and SCN5A were not affected by the M94I mutation of VCL ( xref ,D)."
reach
"According to our findings that VCL directly interacts with SCN5A invivo and invitro and that VCL and SCN5A were colocalized at the ID in the human heart, this functional effect may result from the direct association between VCL and SCN5A.17 However, the fact that VCL-D841H did not affect the interaction between VCL and SCN5A suggested that the molecular mechanism for this functional interaction remains to be addressed."
sparser
"Vinculin Physically and Functionally Interacts With SCN5A."
reach
"In this study, we initially identified that VCL interacts directly with SCN5A in both mouse heart and HEK293 cells transiently expressing VCL and SCN5A."
reach
"Co-immunoprecipitation also showed that VCL-M94I did n't affect the physical interaction between VCL and SCN5A."
reach
"Through biophysical investigation, we have now linked a VCL variant M94I to the loss-of-function of cardiac sodium channel in both HEK293 cells and iPSC-CMs, showing a previously unknown functional interaction between VCL and SCN5A."
sparser
"VCL was also confirmed to directly interact with SCN5A, and VCL-D841H did not disrupt the association of VCL and SCN5A. A VCL common variant was genetically and biophysically associated with Chinese SUNDS."
reach
"The interaction between VCL and SCN5A were also observed in HEK293 cells overexpressing VCL and SCN5A (XREF_FIG), further confirming their direct interaction."
reach
"To explore the relationship between VCL and SCN5A, we used co-immunoprecipitation experiments to examine if VCL physically interacts with SCN5A."
sparser
"These results suggest that VCL-M94I doesn’t disrupt the physical association of VCL and SCN5A."
sparser
"Co-immunoprecipitation also showed that VCL-M94I didn’t affect the physical interaction between VCL and SCN5A. These results suggest the observed functional effect of mutant VCL-M94I on SCN5A does not involve expression and distribution of VCL or SCN5A. The precise mechanism for decreased I Na observed ( xref and xref ) is unclear."
sparser
"As previously reported, xref we identified that VCL directly interacts with SCN5A in vivo and in vitro using coimmunoprecipitations (Figure  xref A and xref B)."
sparser
"More detailed biophysical mechanisms for the alteration of sodium channel kinetics and the functional interaction of VCL with SCN5A remain to be identified."
reach
"VCL directly interacts with SCN5A in vivo and in vitro."
sparser
"In this study, we initially identified that VCL interacts directly with SCN5A in both mouse heart and HEK293 cells transiently expressing VCL and SCN5A. Based on these studies, we speculated that dysfunction of VCL may affect sodium channel function."
sparser
"VCL directly interacts with SCN5A in vivo and in vitro ."
sparser
"Through biophysical investigation, we have now linked a VCL variant M94I to the loss-of-function of cardiac sodium channel in both HEK293 cells and iPSC-CMs, showing a previously unknown functional interaction between VCL and SCN5A. In the myocardial section from the VCL-M94I carrier, we confirmed the co-localization of VCL and SCN5A at ID, but didn’t find significant difference in distribution of both VCL and SCN5A compared to control."
sparser
"The interaction between VCL and SCN5A were also observed in HEK293 cells overexpressing VCL and SCN5A ( xref ), further confirming their direct interaction."
sparser
"To explore the relationship between VCL and SCN5A, we used co-immunoprecipitation experiments to examine if VCL physically interacts with SCN5A. In mouse heart tissues, immunoblot analysis of immunoprecipitated VCL detected the presence of SCN5A, and we also found VCL present following a reciprocal immunoprecipitate using the antibody against SCN5A; due to the negative expression of SCN5A, mouse liver tissue was used as a control ( xref )."
reach
"Furthermore, VCL-D841H does not affect this physical association between VCL and SCN5A."
VCL inhibits SCN5A.
| 1
VCL inhibits SCN5A. 1 / 1
| 1
reach
"Fig. 7B shows the concentration dependence of the moricizine induced tonic block of hH1 at an HP of -100 or -140 mV (n = 5)."
SNTA1 affects SCN5A
2 1 | 7 9
2 1 | 3 3
reach
"The reasons for this are not known, but it could be that there are additional regulatory components in the native myocytes that are regulating the interaction of SNTA1 and SCN5A."
sparser
"The reasons for this are not known, but it could be that there are additional regulatory components in the native myocytes that are regulating the interaction of SNTA1 and SCN5A. Alternatively, the stoichiometry of the transfected/infected components may be different between the two systems."
sparser
"A257G) which precipitated a marked increase in peak I Na and altered Nav1.5 channel kinetics in both HEK293 cells and cardiomyocytes through direct interaction of mutant SNTA1 with SCN5A. xref All these findings suggest that SNTA1 is a crucial Nav1.5 channel interacting protein (ChIP) involved in maintaining the normal function of the cardiac sodium channel."
biogrid
No evidence text available
biogrid
No evidence text available
reach
"Moreover, the functional studies for the complex SCN5A and SNTA1 (lacking both nNOS and PMCA4b) or SCN5A, SNTA1, and nNOS complex (lacking PMCA4b) suggest that the three SNTA1 mutations do not cause increased late I Na by a direct interaction between SNTA1 and SCN5A or between SNTA1 and nNOS."
hprd
No evidence text available
reach
"By using a GST-fusion protein of the C terminus of SCN5A, we showed that WT-SNTA1 interacted with SCN5A, nNOS, and PMCA4b."
sparser
"Moreover, the functional studies for the complex SCN5A-SNTA1 (lacking both nNOS and PMCA4b) or SCN5A-SNTA1-nNOS complex (lacking PMCA4b) suggest that the three SNTA1 mutations do not cause increased late I Na by a direct interaction between SNTA1 and SCN5A or between SNTA1 and nNOS."
SCN5A binds SNTA1, NOS1, and PMCA4b. 4 / 4
| 4
reach
"XREF_BIBR The other three variants (G54R, P56S, and T262P), while considered functionally insignificant in the modification of SCN5A channel biology and now classified as a functional insignificant variant, may have helped nevertheless to elucidate which functional domains of SNTA1 are most important in maintaining integrity and proper function of the SCN5A, nNOS, SNTA1, and PMCA4b complex."
reach
"In conclusion, this study implicates SNTA1 as a novel SIDS-susceptibility gene, whereby mutant SNTA1 disturbs the nNOS, SNTA1, PMCA4b, and SCN5A complex, releasing inhibition of associated nNOS by PMCA4b and resulting in increased peak and late I Na via the up-regulated endogenous NO."
reach
"For the SCN5A, SNTA1, nNOS, and PMCA4b complex it was shown that the SNTA1 mutation disrupted the nNOS suppressor PMCA4b from the complex [XREF_BIBR; XREF_BIBR]; in contrast, Cav3-F97C remains in the complex, but apparently has lost the ability to suppress nNOS."
reach
"In order to observe the effect of NOS inhibitor on the PMCA4b, nNOS, SNTA1, and SCN5A complex, L-NMMA (100 muM) was introduced into the HEK293 cell culture medium 12 hours prior to testing."
SCN5A binds SNTA1 and NOS1. 2 / 2
| 2
sparser
"Based on the associations of nNOS, SNTA1, PMCA4b [ xref ] and SNTA1 with SCN5A [ xref ], the full complex ( xref ) was demonstrated in mouse heart by co-IP [ xref ]."
sparser
"We also performed immunoprecipitation with FLAG antibody using a FLAG-tagged SCN5A co-expressed with nNOS, SNTA1, and Cav3 (WT, F97C, or vector) in HEK cells and found that the complex remained intact with the mutant Cav3 ( xref ) Taken together, these results demonstrate that nNOS, SCN5A and SNTA1 form a complex with Cav3 in the heart."
SCN5A binds SNTA1, CAV3, and NOS1. 2 / 2
| 1 1
sparser
"To demonstrate interactions between SCN5A with SNTA1, nNOS and Cav3, co-IP experiments in rat heart homogenates were performed using nNOS antibody to immunoprecipitate the complex and specific antibodies to detect SCN5A, SNTA1, and Cav3 from the complex (F igure 3E )."
reach
"Cav3-F97C increased peak and late I Na by nNOS dependent S nitrosylation of SCN5A through the SCN5A, SNTA1, nNOS, and Cav3 complex."
SCN5A binds mutated SNTA1. 1 / 1
| 1
reach
"In addition we also have reported a new LQTS associated SNTA1 missense mutation (c. 770C> G, p.A257G) which precipitated a marked increase in peak I Na and altered Nav1.5 channel kinetics in both HEK293 cells and cardiomyocytes through direct interaction of mutant SNTA1 with SCN5A."
sparser
"SNTA1 associates with the cardiac sodium channel SCN5A and the plasma membrane Ca 2+ -ATPase PMCA4B (also known as ATP2B4), and mutations in SNTA1 are associated with long QT syndrome 12 ( xref )."
MEF2C affects SCN5A
| 7 12
MEF2C increases the amount of SCN5A.
| 10
MEF2C increases the amount of SCN5A. 10 / 10
| 10
reach
"These results suggest that MEF2C enhances the transcription of SCN5A through interacting with the MEF2C binding site within SCN5A promoter."
reach
"As expected, knockdown of MEF2C dramatically decreased SCN5A mRNA expression by 22.3% (P < 0.05, Figure XREF_FIG A)."
reach
"MEF2C Enhances SCN5A Transcription."
reach
"Therefore, it is highly likely that MEF2C at least partially mediates the increase of SCN5A mRNA expression in the presence of HuR overexpression."
reach
"Recent studies have shown that the zinc-finger transcription factor, GATA4, and the myocyte enhancing factor-2C (MEF2C) enhances SCN5A transcription."
reach
"Recent studies have shown that the zinc-finger transcription factor, GATA4, and the myocyte enhancing factor-2C (MEF2C) enhances SCN5A transcription."
reach
"As demonstrated by both chromatin immunoprecipitation-quantitative polymerase chain reaction assay and an electrophoretic mobility shift assay, MEF2C enhanced SCN5A transcription by binding to a putative MEF2C binding site within SCN5A promoter region."
reach
"Our data indicated that HuR positively regulated MEF2C mRNA expression and that MEF2C enhanced cardiac sodium channel alpha subunit SCN5A mRNA expression, so it is of great interest to know whether overexpression of HuR increases the SCN5A mRNA expression."
reach
"HuR upregulates MEF2C mRNA expression by protecting MEF2C mRNA from degradation, and consequently, the elevated MEF2C enhances SCN5A mRNA transcription."
reach
"MEF2C Mediated the Increase of SCN5A mRNA Expression in the Presence of HuR Expression."
MEF2C binds SCN5A.
| 7 2
| 7 2
sparser
"The sequences of the oligonucleotides used in the experiment are shown in Figure  xref B. This result further confirmed that MEF2C bound to the SCN5A gene."
reach
"The binding of MEF2C and SCN5A WT oligonucleotides could be competed off with unlabeled WT oligonucleotide but not with unlabeled mutant oligonucleotide."
sparser
"To determine whether MEF2C binds to SCN5A genomic DNA in live cells, we performed ChIP‐qPCR experiments in RL14 cells."
sparser
"The fact revealed by the EMSA experiment that MEF2C was associated with SCN5A sequences confirmed that MEF2C directly interacts with SCN5A gene promoter."
reach
"To determine whether MEF2C binds to SCN5A genomic DNA in live cells, we performed ChIP-qPCR experiments in RL14 cells."
sparser
"A putative MEF2C binding site located in the promoter region of SCN5A suggests that MEF2C regulates SCN5A by binding to this site. xref Our results showing that MEF2C was associated with the SCN5A gene and that overexpression of MEF2C enhanced the luciferase mRNA expression driven by the WT SCN5A promoter support this idea."
sparser
"MEF2C Bound to the SCN5A Promoter Region."
sparser
"We then tested if the association of MEF2C and the SCN5A gene regulated SCN5A transcription."
sparser
"The binding of MEF2C and SCN5A WT oligonucleotides could be competed off with unlabeled WT oligonucleotide but not with unlabeled mutant oligonucleotide (Figure  xref A, lanes 4 and 5)."
Bop affects SCN5A
| 18
| 14
sparser
"For example, despite carrying the mutation since birth, patients with BrS do not typically develop an arrhythmic phenotype until aged approximately 34–53 years. xref Interestingly, the male predominance of an arrhythmic phenotype is not observed in children with BrS. xref Age-dependent hormonal changes have been proposed to explain the increased risk of spontaneous arrhythmias in men after puberty. xref , xref Moreover, within an individual patient with an SCN5A mutation associated with BrS, phenotypic variability exists in the ECG manifestations of the disease as a function of time."
sparser
"SCN5A mutations are associated with both BrS and familial atrial fibrillation, progressive cardiac conduction defect, sick sinus syndrome, early repolarization syndrome, dilated cardiomyopathy, and sudden infant death syndrome. xref Furthermore, BrS has been linked to mutations in 18 other genes, but they are rarer."
sparser
"Genetic analysis revealed a missense mutation in SCN5A (R1193Q) that had been associated with BrS in a previous study [ xref ] and had been characterized as an LQT3 mutation by Wang et al. [ xref ]."
sparser
"Loss-of-function mutations in Scn5a have been associated with BrS (Chen et al., xref ), sick sinus syndrome (SSS; Benson et al., xref ), progressive cardiac conduction defect (PCCD, or Lenègre disease; Schott et al., xref ; Tan et al., xref ; Probst et al., xref ) and overlap disorders between these conditions (Remme et al., xref )."
sparser
"LQTS is typically associated with gain-of-function Na + channel mutations while BrS and ICCD are typically associated with loss-of-function, resulting in reduced I Na ."
sparser
"Nowadays, numerous variations in 23 genes have been linked to BrS since the first gene SCN5A has been associated with BrS in 1998."
sparser
"It has been demonstrated that mutations in SCN5A associated with BrS result in loss-of-function of the current carried by the cardiac type sodium channel (Na v 1.5) xref ."
sparser
"SCN5A mutations associated with BrS are loss-of-function, decreasing Na V 1.5 channel availability or surface expression. xref Loss-of-function mutations have also been found in the CACNA1C -encoded pore-forming subunit of the cardiac Ca V 1.2 L-type Ca 2+ channel. xref , xref In addition, genes associated with BrS include those encoding channel modulators, such as Na + and Ca 2+ channel β subunits and proteins responsible for channel trafficking and targeting within the cardiomyocyte."
sparser
"In general, SCN5A mutations associated with BrS are “loss-of-function” mutations, leading to reduced Na + channel availability, either through decreased membrane surface channel expression or through altered channel gating properties [ xref , xref ]."
sparser
"Loss-of-function mutations in the cardiac sodium channel gene SCN5A are associated with BrS (Kapplinger et al , xref ), PCCD (3), DCM in combination with atrial and ventricular arrhythmias and conduction disease (McNair et al , xref ), sick sinus syndrome (SSS) (Benson et al , xref ), familial atrial fibrillation (AF) (Darbar et al , xref ), and sudden cardiac infant death syndrome (SIDS) (Klaver et al , xref )."
sparser
"It is reported to be more common in Asia than in Western countries, with the estimated prevalence ranging from 1:1000 to 1:10000. xref There are 20 genes associated with BrS, and SCN5A is the major causative one. xref Implantable cardioverter-defibrillator (ICD) is the most effective therapy to prevent SCD, and quinidine, isoproterenol, and catheter ablation are also recommended to reduce the incidence rate of arrhythmic events. xref WPW syndrome is the most common cause of preexcitation, and usually it is presented with supraventricular tachycardia and AF."
sparser
"SCN5A mutations are variously associated with LQTS3, BrS, progressive cardiac conduction defect (PCCD), sick sinus node syndrome (SSS), atrial fibrillation (AF), and even dilated cardiomyopathy (DCM) xref ."
sparser
"BrS is often associated with mutations in SCN5A, encoding Na v 1.5, the α subunit of the major cardiac voltage-gated sodium channel."
sparser
"Mutations in SCN5A are associated with both BrS and Lenègre disease (Schott et al., xref )."
RYR2 binds SCN5A, NTRK3, bop, and type 3. 2 / 2
| 2
sparser
"The four core genes causing IPAS are KCNQ1 associated with long QT syndrome type 1 (LQTS1), KCNH2 associated with long QT syndrome type 2 (LQTS2), SCN5A associated with long QT syndrome type 3 (LQTS3) or BrS and RYR2 associated with CPVT."
sparser
"The four core genes causing IPAS are KCNQ1 associated with long QT syndrome type 1 (LQTS1), KCNH2 associated with long QT syndrome type 2 (LQTS2), SCN5A associated with long QT syndrome type 3 (LQTS3) or BrS and RYR2 associated with CPVT."
sparser
"In 15–20% of BrS patients, the syndrome is associated with mutations in the SCN5A gene encoding the cardiac Na V 1.5 sodium channel [ xref – xref ]."
SCN5A binds PSMD4, TPS-sab, bop, and DCM. 1 / 1
| 1
sparser
"Since then, mutations in all domains of SCN5A have been associated with LQTS, BrS [1], PFHB [ xref ], SSS [ xref ], DCM [ xref ] and l-AF [ xref ]."
SCN5A affects LQT3
| 17
SCN5A activates LQT3.
| 16
SCN5A activates LQT3. 9 / 9
| 9
reach
"LQT1, LQT2, and LQT3 are caused by mutations in KCNQ1 (LQT1), KCNH2 (LQT2), and SCN5A (LQT3), which account for approximately 90% of genotyped LQTS patients."
reach
"Among them most common are LQT1, LQT2, and LQT3, caused by mutations in KCNQ1, KCNH2, and SCN5A genes, respectively (Splawski etal."
reach
"Gain-of-function mutations in the cardiac sodium channel gene Scn5a can cause long QT syndrome 3 (LQT3) and arrhythmic death by torsades de pointes (TdP)."
reach
"LQT3 is caused by gain of function mutations in SCN5A 4 and increased I Na current during the plateau and late phase of the action potential (AP)."
reach
"LQT3 is caused by mutations in the gene SCN5A, which encodes the alpha-subunit for the sodium channel."
reach
"Mutations in SCN5A on chromosome 3p21, encoding the human heart voltage gated sodium-channel alpha-subunit, cause LQT3."
reach
"For instance, mutated Cav3 disrupts SCN5A function causing LQT3 and arrhythmias."
reach
"LQT3 is caused by defects in the voltage dependent sodium channel gene SCN5A."
reach
"LQT1 and LQT2 are caused due to mutations in the potassium channel genes, KCNQ1 (OMIM # 607542) and KCNH2 (OMIM # 152427) respectively, while LQT3 is caused by mutations in a sodium channel gene, SCN5A (OMIM # 600163) XREF_BIBR."
Mutated SCN5A activates LQT3. 7 / 7
| 7
reach
"The LQT3 phenotype is only caused by mutations of the SCN5A (LQT3) gene (so far)."
reach
"The realization that SCN5A mutations producing LQT3 have a " gain-of-function " effect has lent support to our early suggestion to test sodium channel blockers, and especially mexiletine, as possible adjuvants in the management of LQT3 patients."
reach
"Compound SCN5A mutations causing LQT3 are uncommon, and in some instances one mutation rescues the Na + channel abnormalities of the other [XREF_BIBR - XREF_BIBR]."
reach
"For instance, SCN5A mutations can cause not only LQT3 and BrS, but also cardiac conduction disease, sick sinus syndrome, atrial fibrillation, or dilated cardiomyopathy."
reach
"SCN5A mutations producing LQT3 generally exhibit a disruption in channel inactivation leading to an increase in persistent current, which has pathophysiological relevance during the plateau phase of the action potential."
reach
"Interestingly, SCN5A mutations also cause LQT3, and some specific " overlap " mutations have been implicated in both BrS and LQT3."
reach
"The LQT3 form of this disease is caused by mutations of the SCN5A sodium-channel gene."
SCN5A binds LQT3.
| 1
SCN5A binds LQT3. 1 / 1
| 1
reach
"To date, mutational analyses have revealed about 103 distinct mutations in SCN5A, of which at least more than 30 mutations are associated with LQT3, whereas the rest of the mutations are affiliated with the remaining sodium channel disorders."
SCN5A affects PSMD4
| 11 4
SCN5A binds PSMD4.
| 11 1
| 7 1
sparser
"However, mutations in genes other than SCN5A have also been associated with AF, including SCN10A and SCN1B ."
sparser
"14 Finally, two very recent publications have demonstrated that SCN5A mutations are associated with AF, both in isolated forms 15,16 and in patients with underlying heart disease."
sparser
"For example, variations in the gene SCN5A, which is associated with lone AF [ xref ], have shown to accelerate the process of ventricular fibrosis [ xref ] that may in turn be responsible for a prolonged QRSd."
reach
"One loss of function variant was identified in the cardiac sodium channel, SCN5A that resulted in reduced peak sodium current density and has previously been associated with AF."
sparser
"We hypothesized that early-onset lone AF was associated with genetic variation in SCN5A. The coding sequence of SCN5A was sequenced in 192 patients with early-onset lone AF."
sparser
"There are mutations or rare variants in SCN5A that have been associated with familial AF [ xref , xref ]."
sparser
"It is, however, noteworthy that SCN5A mutations have been associated with AF in patients with Brugada [ xref ]."
sparser
"These results indicate that a defect in the SCN5A gene is not associated with AF events or with VF events as was previously reported ( 1 ), suggesting that genetic analysis is not useful for risk stratification."
| 1
sparser
"In addition, variations in the KCNE5 and SCN5A genes have been associated with AF, the latter encoding the cardiac sodium channel Na v 1.5."
| 1
sparser
"In contrast, Benito et al. [ xref ] described a family, with eight members across three generations, showing both early onset AF and LQT3 associated with a mutant SCN5A gene involving the Y1795C mutation."
sparser
"SCN5A and SCN10A cardiac sodium channel related genes are associated with AF."
SCN5A binds PSMD4, TPS-sab, bop, and DCM. 1 / 1
| 1
sparser
"Since then, mutations in all domains of SCN5A have been associated with LQTS, BrS [1], PFHB [ xref ], SSS [ xref ], DCM [ xref ] and l-AF [ xref ]."
SCN5A activates PSMD4.
| 3
SCN5A activates PSMD4. 2 / 2
| 2
reach
"The pacing-control group exhibited shortened AERP, decreased CV, increased AF inducibility and tissue fibrosis, and down-regulated L-type Ca (2+) channel (LCC), SCN5A, Kv4.3 and connexin43 (Cx43)."
reach
"Chronic treatment with oral flecainide was recommended to both patients; both refused this approach unless new episodes of atrial arrhythmia occurred.In this report we describe, for the first time, a family with inherited LQT-3 and paroxysmal AF caused by a single Y1795C mutation in the SCN5A gene."
Mutated SCN5A activates PSMD4. 1 / 1
| 1
reach
"Flecainide is the drug of choice in AF caused by gain of function SCN5A mutations and in prevention of atrial arrhythmias in LQT-3 [XREF_BIBR, XREF_BIBR]."
Flecainide affects SCN5A
| 14
Flecainide activates SCN5A.
| 12
| 12
reach
"On the other hand, the conduction slowing in RyR2 S/S mice was quantitatively similar to that observed in heterozygous Na + channel Na v 1.5-subunit knock-out (SCN5A +/-) mice, or WT mice treated with flecainide, pointing to the possibility that drugs which further compromise CV or excitability may be even proarrhythmic."
reach
"Flecainide increased the latencies in Scn5a +/- RV epicardium (from 24.59 (6.68) to 38.20 (18.94) ms; U = 21.0, P = 1.6 x 10 -4, r = 0.67)."
reach
"In contrast, they exerted more noticeable effects particularly in the RV of Scn5a +/- hearts, where the DeltaVERP was significantly increased (from 9.1 +/-1.1 to 21 +/-0.9 ms, p < 0.05, n = 6) by flecainide and significantly decreased (to 4.5 +/-0.5 ms, p < 0.05, n = 6) by quinidine."
reach
"Fourthly, the pro- and anti-arrhythmic agents flecainide and quinidine both increased VERPs in both WT and Scn5a +/- hearts in all regions, although the effect was more pronounced with quinidine than flecainide (e.g. 39.9 +/-0.9 ms before drug to 45.3 +/-2.6 ms with flecainide and to 73.3 +/-1.5 ms with quinidine, p < 0.05, n = 6 for the RV in Scn5a +/-; Fig."
reach
"Our findings of heightened QT dispersion in Scn5a +/- hearts, further increased by flecainide but not by quinidine, directly parallel the respective pro- and antiarrhythmic effects of the 2 drugs experimentally and clinically."
reach
"Furthermore, recent studies have implicated increased repolarization gradients across the RV wall in the arrhythmogenic mechanism in Scn5a +/- mice, which are increased by flecainide but reduced by quinidine."
reach
"Flecainide treatment increased theta ' alternans in Scn5a +/- RV epicardium, in accord with the changes in maximum theta ' and conduction failure."
reach
"Conduction velocity restitution showed lower initial values and earlier points of failure during incremental pacing in the murine Scn5a +/- right ventricle (RV) epicardium particularly when treated with flecainide."
reach
"However, flecainide prolonged APD (90) in WT but not Scn5a +/-, whereas quinidine prolonged APD (90) in both WT and Scn5a +/-."
reach
"However, at higher rates of 13.5 Hz, corresponding to exercising heart rates, flecainide treatment increased the magnitude of theta ' alternans specifically in the Scn5a +/- RV epicardium (from 0.00 (0.00) to 0.0051 (2.55) ms -1, P = 0.021)."
reach
"Flecainide therefore causes premature conduction failure in the Scn5a +/- RV at higher pacing rates."
reach
"Flecainide increased the RTD in the LV and RV of Scn5a +/- hearts, while quinidine decreased it in both."
Flecainide inhibits SCN5A.
| 2
| 2
reach
"Flecainide further reduced theta ' max in the Scn5a +/- RV epicardium (from 0.05 (0.01) to 0.03 (0.028) ms -1; U = 18.0, P = 0.026, r = 0.54)."
reach
"Flecainide reduced the BCD ' in the Scn5a +/- RV epicardium (from 3.42 (0.77) to 2.66 (0.82); U = 20.0, P = 0.030, r = 0.48)."
SCN5A affects MEF2C
| 7 6
SCN5A binds MEF2C.
| 7 2
| 7 2
sparser
"The sequences of the oligonucleotides used in the experiment are shown in Figure  xref B. This result further confirmed that MEF2C bound to the SCN5A gene."
reach
"The binding of MEF2C and SCN5A WT oligonucleotides could be competed off with unlabeled WT oligonucleotide but not with unlabeled mutant oligonucleotide."
sparser
"To determine whether MEF2C binds to SCN5A genomic DNA in live cells, we performed ChIP‐qPCR experiments in RL14 cells."
sparser
"The fact revealed by the EMSA experiment that MEF2C was associated with SCN5A sequences confirmed that MEF2C directly interacts with SCN5A gene promoter."
reach
"To determine whether MEF2C binds to SCN5A genomic DNA in live cells, we performed ChIP-qPCR experiments in RL14 cells."
sparser
"A putative MEF2C binding site located in the promoter region of SCN5A suggests that MEF2C regulates SCN5A by binding to this site. xref Our results showing that MEF2C was associated with the SCN5A gene and that overexpression of MEF2C enhanced the luciferase mRNA expression driven by the WT SCN5A promoter support this idea."
sparser
"MEF2C Bound to the SCN5A Promoter Region."
sparser
"We then tested if the association of MEF2C and the SCN5A gene regulated SCN5A transcription."
sparser
"The binding of MEF2C and SCN5A WT oligonucleotides could be competed off with unlabeled WT oligonucleotide but not with unlabeled mutant oligonucleotide (Figure  xref A, lanes 4 and 5)."
SCN5A increases the amount of MEF2C.
| 4
SCN5A increases the amount of MEF2C. 4 / 4
| 4
reach
"HuR upregulates MEF2C mRNA expression by protecting MEF2C mRNA from degradation, and consequently, the elevated MEF2C enhances SCN5A mRNA transcription."
reach
"MEF2C Enhances SCN5A Transcription."
reach
"As demonstrated by both chromatin immunoprecipitation-quantitative polymerase chain reaction assay and an electrophoretic mobility shift assay, MEF2C enhanced SCN5A transcription by binding to a putative MEF2C binding site within SCN5A promoter region."
reach
"We then tested if the association of MEF2C and the SCN5A gene regulated SCN5A transcription."
RBM25 affects SCN5A
| 2 11
RBM25 binds SCN5A.
| 2 4
| 2 4
reach
"Our results show that angiotensin II and hypoxia, signals common to HF, result in increased LUC7L3 and RBM25 splicing regulators, increased binding of RBM25 to SCN5A mRNA, increased SCN5A splice variant abundances, decreased full-length SCN5A mRNA and protein, and decreased Na (+) current."
sparser
"Our results shows that AngII and hypoxia, signals common to HF, result in increased LUC7L3 and RBM25 splicing regulators, increased binding of RBM25 to SCN5A mRNA, increased SCN5A splice variant abundances, decreased full-length SCN5A mRNA and protein, and decreased Na + current."
sparser
"In summary, AngII and hypoxia, signals common to HF, result in increased hLuc7A and RBM25 protein, increased binding of RBM25 to SCN5A mRNA, increased SCN5A splice variant abundances, decreased full-length SCN5A mRNA and protein, and decreased Na + current."
reach
"RBM25 was bound to the wild-type SCN5A sequence in a concentration dependent manner (XREF_FIG)."
reach
"In summary, AngII and hypoxia, signals common to HF, result in increased hLuc7A and RBM25 protein, increased binding of RBM25 to SCN5A mRNA, increased SCN5A splice variant abundances, decreased full-length SCN5A mRNA and protein, and decreased Na + current."
reach
"Our results shows that AngII and hypoxia, signals common to HF, result in increased LUC7L3 and RBM25 splicing regulators, increased binding of RBM25 to SCN5A mRNA, increased SCN5A splice variant abundances, decreased full-length SCN5A mRNA and protein, and decreased Na + current."
RBM25 activates SCN5A.
| 6
RBM25 activates SCN5A. 5 / 5
| 5
reach
"Finally, while experimental manipulations of RBM25 and LUC7L3 were sufficient to cause or prevent SCN5A mRNA dysregulation, it remains possible that some of the other splicing factors increased in HF contribute to abnormal SCN5A splicing."
reach
"LUC7L3 and RBM25 were elevated in human HF tissue and mediated abnormal SCN5A splicing regulation in the two cell types tested."
reach
"RBM25 and LUC7L3complex mediates abnormal SCN5A mRNA regulation."
reach
"Two of these splicing factors, RBM25 and LUC7L3, were elevated in human heart failure tissue and mediated truncation of SCN5A mRNA in both Jurkat cells and human embryonic stem cell derived cardiomyocytes."
reach
"The splicing factors RBM25 and LUC7L3 are elevated in human heart failure tissue and mediate truncation of SCN5A mRNA in both Jurkat cells and human embryonic stem cell derived cardiomyocytes [XREF_BIBR]."
RBM25 bound to LUC7L3 activates SCN5A. 1 / 1
| 1
reach
"Recently, the RBM25 and Luc7A complex was also reported to mediate pathological SCN5A mRNA splicing in human heart failure [XREF_BIBR]."
RBM25 inhibits SCN5A.
| 1
RBM25 inhibits SCN5A. 1 / 1
| 1
reach
"While downregulation of the two splicing factors in Jurkat cells reduced the SCN5A variants E28C and E28D, overexpression of RBM25 and LUC7L3 increased E28C and E28D and decreased the full length SCN5A mRNA abundances."
PSMD4 affects SCN5A
| 11 2
PSMD4 binds SCN5A.
| 11 1
| 7 1
sparser
"However, mutations in genes other than SCN5A have also been associated with AF, including SCN10A and SCN1B ."
sparser
"14 Finally, two very recent publications have demonstrated that SCN5A mutations are associated with AF, both in isolated forms 15,16 and in patients with underlying heart disease."
sparser
"For example, variations in the gene SCN5A, which is associated with lone AF [ xref ], have shown to accelerate the process of ventricular fibrosis [ xref ] that may in turn be responsible for a prolonged QRSd."
reach
"One loss of function variant was identified in the cardiac sodium channel, SCN5A that resulted in reduced peak sodium current density and has previously been associated with AF."
sparser
"We hypothesized that early-onset lone AF was associated with genetic variation in SCN5A. The coding sequence of SCN5A was sequenced in 192 patients with early-onset lone AF."
sparser
"There are mutations or rare variants in SCN5A that have been associated with familial AF [ xref , xref ]."
sparser
"It is, however, noteworthy that SCN5A mutations have been associated with AF in patients with Brugada [ xref ]."
sparser
"These results indicate that a defect in the SCN5A gene is not associated with AF events or with VF events as was previously reported ( 1 ), suggesting that genetic analysis is not useful for risk stratification."
| 1
sparser
"In addition, variations in the KCNE5 and SCN5A genes have been associated with AF, the latter encoding the cardiac sodium channel Na v 1.5."
| 1
sparser
"In contrast, Benito et al. [ xref ] described a family, with eight members across three generations, showing both early onset AF and LQT3 associated with a mutant SCN5A gene involving the Y1795C mutation."
sparser
"SCN5A and SCN10A cardiac sodium channel related genes are associated with AF."
SCN5A binds PSMD4, TPS-sab, bop, and DCM. 1 / 1
| 1
sparser
"Since then, mutations in all domains of SCN5A have been associated with LQTS, BrS [1], PFHB [ xref ], SSS [ xref ], DCM [ xref ] and l-AF [ xref ]."
PSMD4 increases the amount of SCN5A.
| 1
PSMD4 increases the amount of SCN5A. 1 / 1
| 1
reach
"In the pacing control group, AERP shortening, decreased CV, increased AF inducibility and downregulation of the expression of SCN5A and LCC were observed."
SCN5A affects cell death
| 12
SCN5A activates cell death.
| 9
| 5
reach
"Mutations in the SCN5A gene have been linked to a variety of diseases causing sudden cardiac death, with important variability in expressivity and phenotypic overlap."
reach
"Brugada syndrome is an inherited cardiac disorder caused by mutations in the cardiac sodium channel gene, SCN5A, that leads to ventricular fibrillation and sudden death."
reach
"The SCN5A gene encodes cardiac sodium channel Na v 1.5 and causes lethal ventricular arrhythmias and sudden death and atrial fibrillation (AF) when mutated."
reach
"Gain-of-function mutations in the cardiac sodium channel gene Scn5a can cause long QT syndrome 3 (LQT3) and arrhythmic death by torsades de pointes (TdP)."
reach
"Pathogenic mutations in the cardiac sodium channel gene, SCN5A, cause approximately 15 to 20% of Brugada syndrome (BrS1), 5 to 10% of long QT syndrome (LQT3), and 2 to 5% of sudden infant death syndrome."
Mutated SCN5A activates cell death. 3 / 3
| 3
reach
"Some SCN5A mutations may cause death or severe manifestations in some people and may not cause any symptoms or arrhythmias in others."
reach
"Brugada syndrome (BrS) is an inheritable sudden cardiac death disease mainly caused by SCN5A mutations."
reach
"Furthermore, our results suggest that overexpression of an SCN5A mutation not only increases the occurrence of arrhythmias and sudden death, but also increases the risk for development of cardiac pump failure."
SCN5A-N1325S activates cell death. 1 / 1
| 1
reach
"Mechanisms by which SCN5A mutation N1325S causes cardiac arrhythmias and sudden death in vivo."
SCN5A binds cell death.
| 2
reach
"In this study, we report a de novo mutation in the sodium channel gene SCN5A, which is associated with sudden infant death."
Cell death binds mutated SCN5A. 1 / 1
| 1
reach
"A homozygous SCN5A mutation associated with atrial standstill and sudden death."
SCN5A inhibits cell death.
| 1
| 1
reach
"Rare loss-of-function variants in SCN5A have been found to cause delayed conduction with prolonged PR interval and QRS (MIM 600163.0016) XREF_BIBR, atrial fibrillation, XREF_BIBR sudden cardiac death, XREF_BIBR sick sinus syndrome (MIM 608567), XREF_BIBR Brugada syndrome (MIM 601144), XREF_BIBR dilated cardiomyopathy (MIM 601154), XREF_BIBR and Progressive Familial Heart Block (MIM 113900)."
SCN5A affects NOS1
| 7 5
SCN5A binds SNTA1, NOS1, and PMCA4b. 4 / 4
| 4
reach
"XREF_BIBR The other three variants (G54R, P56S, and T262P), while considered functionally insignificant in the modification of SCN5A channel biology and now classified as a functional insignificant variant, may have helped nevertheless to elucidate which functional domains of SNTA1 are most important in maintaining integrity and proper function of the SCN5A, nNOS, SNTA1, and PMCA4b complex."
reach
"In conclusion, this study implicates SNTA1 as a novel SIDS-susceptibility gene, whereby mutant SNTA1 disturbs the nNOS, SNTA1, PMCA4b, and SCN5A complex, releasing inhibition of associated nNOS by PMCA4b and resulting in increased peak and late I Na via the up-regulated endogenous NO."
reach
"For the SCN5A, SNTA1, nNOS, and PMCA4b complex it was shown that the SNTA1 mutation disrupted the nNOS suppressor PMCA4b from the complex [XREF_BIBR; XREF_BIBR]; in contrast, Cav3-F97C remains in the complex, but apparently has lost the ability to suppress nNOS."
reach
"In order to observe the effect of NOS inhibitor on the PMCA4b, nNOS, SNTA1, and SCN5A complex, L-NMMA (100 muM) was introduced into the HEK293 cell culture medium 12 hours prior to testing."
| 3
sparser
"A257G-SNTA1 can functionally interact with SCN5A in HEK293 cells without requiring nNOS or PMCA4b."
sparser
"Like other syntrophin isoforms (β1, β2, γ1, and γ2), SNTA1 (α1) comprises four conserved domains, two pleckstrin homology domains (PH1 and PH2) which are involved in the recruitment of proteins to the sarcolemma, xref a PDZ domain which inserts within PH1 and has been shown to bind to nNOS and SCN5A, xref , xref and a syntrophin unique COOH-terminal domain (SU) which binds SNTA1 to dystrophin. xref The fact that there are up to four SNTA1 binding sites in close proximity within a single dystrophin complex xref suggests that SNTA1 probably brings several signaling molecules together to form a large signaling complex. xref "
sparser
"Based on previous studies in which interaction of nNOS with SCN5A was identified [ xref ; xref ; xref ], we hypothesized that there might be endogenous nNOS activity in HEK-293 cells which might underlie the increased late I Na for Cav3-F97C. We performed RT-PCR assay using nNOS-specific primers (forward: 5 acgtcttcctcatgtctaagttca; reverse: 5 ctgtgacaactcccgctaca) to detect the nNOS mRNA in the cell lysates."
SCN5A binds SNTA1 and NOS1. 2 / 2
| 2
sparser
"Based on the associations of nNOS, SNTA1, PMCA4b [ xref ] and SNTA1 with SCN5A [ xref ], the full complex ( xref ) was demonstrated in mouse heart by co-IP [ xref ]."
sparser
"We also performed immunoprecipitation with FLAG antibody using a FLAG-tagged SCN5A co-expressed with nNOS, SNTA1, and Cav3 (WT, F97C, or vector) in HEK cells and found that the complex remained intact with the mutant Cav3 ( xref ) Taken together, these results demonstrate that nNOS, SCN5A and SNTA1 form a complex with Cav3 in the heart."
SCN5A binds SNTA1, CAV3, and NOS1. 2 / 2
| 1 1
sparser
"To demonstrate interactions between SCN5A with SNTA1, nNOS and Cav3, co-IP experiments in rat heart homogenates were performed using nNOS antibody to immunoprecipitate the complex and specific antibodies to detect SCN5A, SNTA1, and Cav3 from the complex (F igure 3E )."
reach
"Cav3-F97C increased peak and late I Na by nNOS dependent S nitrosylation of SCN5A through the SCN5A, SNTA1, nNOS, and Cav3 complex."
| 1
sparser
"Thus, the association of nNOS complex-related proteins with both SCN5A and other cardiac ion channels deserves further study."
FOXO1 affects SCN5A
| 3 9
FOXO1 binds SCN5A.
| 3 2
| 3 2
sparser
"To confirm the association of Foxo1 with the SCN5a promoter region including IREs, a ChIP assay was carried out in HL-1 cells and mouse ventricular myocytes, and it unveiled a clear enrichment of DNA amplified by PCR with two sets of primer pairs flanking Foxo1 binding IREs ( 5′-CAAAACAAAACA-3′ ) in the proximal SCN5a promoter region following immunoprecipitation with Foxo1 antibody, but not with IgG control ( xref )."
reach
"Foxo1 binds the promoter region of SCN5A [XREF_BIBR], and exogenous Foxo1 expression decreases SCN5A promoter activity in HL-1 cells [XREF_BIBR]."
reach
"Foxo1 directly binds SCN5a promoter."
sparser
"Foxo1 directly binds SCN5a promoter."
sparser
"Foxo1 binds the promoter region of SCN5A [ xref ], and exogenous Foxo1 expression decreases SCN5A promoter activity in HL-1 cells [ xref ]."
FOXO1 inhibits SCN5A.
| 4
FOXO1 inhibits SCN5A. 4 / 4
| 4
reach
"Foxo1 Negatively Regulates SCN5a Promoter Activity."
reach
"XREF_BIBR Accordingly, FoXO1 expression in HL-1 cells decreased SCN5A promoter activity whereas FoxO1 siRNA increased sodium protein in these cells XREF_BIBR."
reach
"Both NF-kappaB and FoxO1 suppress SCN5a promoter activity, leading to the down-regulation of Na V 1.5 expression [XREF_BIBR, XREF_BIBR], indicating that these two signaling pathways play important roles in the regulation of Na + channel activity in heart diseases."
reach
"Expression of Foxo1 significantly suppressed SCN5a promoter activity (p < 0.01), and the suppression was Foxo1 dose dependent (XREF_FIG)."
FOXO1 activates SCN5A.
| 2
FOXO1 activates SCN5A. 2 / 2
| 2
reach
"In this study, we demonstrated that Foxo1 directly targeted the SCN5a promoter and inhibited its transcriptional activity."
reach
"Elevated levels of reactive oxygen species (ROS) in IHD [XREF_BIBR - XREF_BIBR] induced the nuclear localization of FoxO1 in both HL-1 [XREF_BIBR] and rat neonatal cardiomyocytes [XREF_BIBR] potentially through acetylation [XREF_BIBR] and phosphorylation at serine 212 by mammalian sterile 20 like kinase 1 [XREF_BIBR] and suppresses Na V 1.5 expression through FoxO1 mediation of the SCN5a promoter activity [XREF_BIBR]."
FOXO1 decreases the amount of SCN5A.
| 1
FOXO1 decreases the amount of SCN5A. 1 / 1
| 1
reach
"XREF_BIBR - XREF_BIBR A recent study has indicated that FOXO1 negatively regulates SCN5A transcription, XREF_BIBR and effect that can be inhibited by Akt induced phosphorylation and translocation of FOXO1 from the nucleus to the cytoplasm."
| 11
sparser
"Direct Ca 2+ binding to hH1 domain of sodium channel was shown to induce a rightward shift in the steady state inactivation increasing the availability of channels at more positive potentials [ xref ], therefore buffering cytosolic Ca 2+ should reduce Na + current."
sparser
"Brugada syndrome has so far been associated with only one gene, SCN5A, which encodes the cardiac sodium channel."
sparser
"Furthermore, mutations in the SCN5A sodium channel gene have been associated with an increased risk of arrhythmic events xref ."
sparser
"Preliminary reports indicate an important association with SCN10A , a neuronal sodium channel that co-associates with SCN5A, with a yield as high as 20%."
sparser
"Mutations in SCN5A, the cardiac sodium channel gene, are associated with varied arrhythmia phenotypes, e.g. long QT syndrome (LQTS), Brugada syndrome (BrS), sick sinus syndrome (SSS), progressive atrioventricular (AV) conduction system disease, ventricular fibrillation and dilated cardiomyopathy. xref Although these arrhythmia phenotypes were originally considered distinct entities, overlap in the clinical presentation has been frequently noted. xref – xref The clinical heterogeneity associated with SCN5A mutations is partly explained by corresponding differences in the degree and characteristics of sodium channel dysfunction."
sparser
"In patients, deletions or loss-of-function mutations of the cardiac sodium channel gene, SCN5A, have been associated with a wide range of arrhythmias including bradycardia (heart rate slowing), atrioventricular conduction delay, and ventricular fibrillation."
sparser
"Mutations in SCN5A, a cardiac sodium channel gene, have been recently associated with Brugada syndrome."
sparser
"Scn5a, which forms the actual pore of the VGSC, is sufficient to enhance this ligand sensitivity in the absence of Scn4b, which serves as a modifier of the electrophysiological properties of the channel."
sparser
"In 15–20% of BrS patients, the syndrome is associated with mutations in the SCN5A gene encoding the cardiac Na V 1.5 sodium channel [ xref – xref ]."
sparser
"Previous functional analyses in HEK293 and neonatal rat cardiomyocytes demonstrated that ZASP interacts with the SCN5A -coded sodium channel Na v 1.5, and affects the channel voltage-dependent activation and inactivation, leading to loss of function of Na v 1.5, consistent with the conduction defects seen in the variant harboring patients [ xref ]."
sparser
"SCN5A and SCN10A cardiac sodium channel related genes are associated with AF."
FOXH1 affects SCN5A
| 10
| 10
sparser
"Thus, Lqh III is much more potent to remove fast inactivation of hH1 channels than Lqh II and LqhαIT."
sparser
"Lqh Toxins Modify Activation and Fast Inactivation of hH1 Channels."
sparser
"Thus, Lqh III not only removes fast inactivation of hH1 channels at lower concentrations, but also slows down inactivation more extensively than the other two toxins tested."
sparser
"LQT3 arises from mutations that disrupt fast inactivation of the cardiac sodium channel SCN5A ( xref )."
sparser
"Although under control conditions hH1 channels inactivate rapidly and completely, Lqh II and Lqh III at that low concentration strongly slowed down fast inactivation of hH1 channels."
sparser
"The EC 50 values of Lqh II, Lqh III, and LqhαIT to remove fast inactivation of hH1 channels are 12, <2.5, and 33 nM, respectively, compared with those in μI channels of 1.4, 7.2, and 0.5 nM, respectively."
sparser
"In the control, fast inactivation of hH1 channels after 5 ms increases with increasing test voltage, and is complete at ∼0 mV."
sparser
"After obtaining stable toxin effects at a concentration of 100 nM, toxin dissociation rates in hH1 channels were obtained in a voltage range from +20 to +180 mV with protocols like that shown in xref A. As shown in xref (B and C) a 100-ms dissociation pulse to +120 mV almost completely removed the effects of 100 nM Lqh II and LqhαIT on fast inactivation of hH1 channels, whereas a 540-ms dissociation pulse to the same voltage only partially removed the effects of Lqh III on fast inactivation."
sparser
"We also studied the rates of fast inactivation of SkM1 and SCN5A. We took the falling phase (starting from around 2/3 of the maximal current to full inactivation, xref ) of Na + current measured in the activation experiment, and then fit the data with an exponential function to get a time constant (τ) of inactivation at each membrane potential ( xref )."
sparser
"In the chimaeras, activation resembled that of mu1, fast inactivation resembled that of hH1, and steady-state fast inactivation fell between that of hH1 and mu1."
Mexiletine affects SCN5A
| 9
Mexiletine activates SCN5A.
| 8
| 3
reach
"Of note, a severe IBS-C case with a highly penetrating SCN5A loss-of-function mutation could be successfully treated with mexiletine, a drug known to restore Na V 1.5 channel function."
reach
"A novel SCN5A arrhythmia mutation, M1766L, with expression defect rescued by mexiletine."
reach
"Patients included in the study were referred to the Molecular Cardiology Division at ICS Maugeri Hospital in Pavia, Italy Patients were genotyped and identified as carriers of a DNA variant in the coding sequence of the SCN5A gene and they were treated with mexiletine."
Mexiletine activates mutated SCN5A. 3 / 3
| 3
reach
"However, some reports have shown that mexiletine, a drug used to inhibit persistent sodium current and to shorten QT interval, rescues trafficking in defective SCN5A mutants."
reach
"This is remarkable, since genetic defects in the voltage gated channel SCN5A have been found in a subset of patients with IBS, and normal stool frequency was restored in a severely constipated SCN5A mutant carrier treated with mexiletine, a drug able to rescue SCN5A expression."
reach
"The only one alive, currently at age 3, carries one of the functionally most severe SCN5A mutations 14 and is treated with beta-blockers, mexiletine, and ventricular pacing."
Mexiletine activates SCN5A-N406K. 2 / 2
| 2
reach
"The decrease in cell surface expression caused by SCN5A N406K mutants was reversed by mexiletine, further supporting the hypothesis that mexiletine could increase the peak I Na of SCN5A N406K mutation through rescuing the trafficking defect of SCN5A-N406K."
reach
"We discovered mexiletine could elevate the reduced peak sodium current and inhibit the increased late sodium current at the same time, and partially restore the function of SCN5A N406K mutant channel with a mixed biophysical phenotype."
Mexiletine inhibits SCN5A.
| 1
Mexiletine inhibits mutated SCN5A. 1 / 1
| 1
reach
"Consequently, the pharmacological blocker of sodium current, mexiletine, shortens the QTc interval and rescues the defect of the SCN5A mutation."
Cocaine affects SCN5A
| 9
| 9
reach
"When we delivered a single conditioning pulse to +30 mV for 300 ms followed by a 100-ms interval at the holding potential and a test pulse to +30 mV, cocaine blocked a similar percentage of mu 1 channels (29.7 +/- 2.0%; n = 7) and hH1 channels (24.6 +/- 1.0%; n = 5; p> 0.05)."
reach
"The simulation predicted steady-state cocaine block of mu 1 channels within a few millivolts at the midpoint of block, whereas steady-state cocaine block of hH1 channels was several millivolts more negative than predicted by the simulation."
reach
"At intermediate voltages (-120 mV to -90 mV), however, cocaine blocked hH1 channels with much greater potency, suggesting that the modulation of receptor affinity differs at the two isoforms."
reach
"The time constants of recovery from 30 mu M cocaine block of mu 1 and hH1 channels were 6.5 +/- 0.4 s (n = 5) and 6.8 +/- 0.5 s (n = 6; p> 0.5), respectively."
reach
"We compared use dependent cocaine block of mu 1 and hH1 channels using 1 and 2 Hz stimulation rates but found no difference between the channels in the extent of use dependent block."
reach
"The fractional amplitudes of the fast time constants of recovery from cocaine block of mu 1 and hH1 channels were 26.3 +/- 1.4% and 27.5 +/- 1.4% (p> 0.05), respectively."
reach
"Although we lacked direct evidence to support our hypothesis, we suggested that cocaine blocked a larger proportion of hH1 channels than mu 1 channels at intermediate voltages because of greater steady-state inactivation of the hH1 isoform (Wright et al., 1997)."
reach
"We suggested that the differences in steady-state inactivation between hH1 channels and mu 1 channels may in part explain the cardiotoxic effects of cocaine.In the present study we further addressed state dependent cocaine block of mu 1 and hH1 sodium channels by focusing on the mechanisms responsible for the greater cocaine block of the hH1 isoform at intermediate voltages."
reach
"At strongly negative conditioning pulses, 30 mu M cocaine blocked ~ 10% of the resting mu 1 (1-3) hH1 (4) and mu 1 (1) hH1 (2-4) channels, which was similar to the block of resting mu 1 and hH1 channels."
SCN5A affects NAV1
| 2 7
SCN5A activates NAV1.
| 6
SCN5A-R1193Q activates NAV1. 3 / 3
| 3
reach
"This also indicated that SCN5A (R1193Q) does not modulate the NaV1.5 channel in response to an acute body temperature change."
reach
"This suggested that SCN5A (R1193Q) does not modulate the NaV1.5 channel regardless of temperature."
reach
"Here, we experimentally assessed whether SCN5A (R1193Q) modulates the NaV1.5 channel at various temperatures including normal and febrile body temperatures."
SCN5A activates NAV1. 2 / 2
| 2
reach
"Gain-of function variants in SCN5A (LQT3) induce an increased late inward Nav1.5 current that slows cardiac repolarization, also causing a prolonged QT interval [XREF_BIBR]."
reach
"The disorder is caused by mutations in the SCN5A gene encoding Nav1.5, the cardiac sodium channel, which is the only gene in which mutations were found to cause the disease."
Mutated SCN5A activates NAV1. 1 / 1
| 1
reach
"It has previously been shown that some SCN5A mutations associated with Brugada syndrome enhance the steady-state inactivation of Nav1.5 channels by promoting the entry of the channel into an intermediate inactivated state [XREF_BIBR, XREF_BIBR, XREF_BIBR]."
SCN5A binds NAV1.
| 2
| 2
sparser
"Most NaV1.5 mutations associated with LQT3 promote a mode of sodium channel gating in which some channels fail to inactivate, contributing to increased late sodium current (INaL), which is directly responsible for delayed repolarization and prolongation of the QT interval."
sparser
"Mutations in the SCN5A gene, which encodes the Nav1.5 protein forming the α subunit of the sodium channel, are common in BrS, accounting for approximately 20% to 25% of cases.[ xref ]In our case, no abnormity in the SCN5A gene was detected."
SCN5A inhibits NAV1.
| 1
Mutated SCN5A inhibits NAV1. 1 / 1
| 1
reach
"Y1767C, a novel SCN5A mutation, induces a persistent Na+ current and potentiates ranolazine inhibition of Nav1.5 channels."
GPD1L affects SCN5A
| 2 7
GPD1L binds SCN5A.
| 2 1
| 2 1
sparser
"They demonstrated association of GPD1L with SCN5A; mutants of GPD1L increased PKC-mediated phosphorylation of SCN5A which in turn causes a dysfunction in sodium current, a mechanism for ventricular arrhythmias."
sparser
"Using a heterologous expression system, we show that GPD1L associated with SCN5A and that the BrS- and SIDS-related mutations in GPD1L caused a loss of enzymatic function resulting in glycerol-3-phosphate PKC-dependent phosphorylation of SCN5A at serine 1503 (S1503) through a GPD1L-dependent pathway."
reach
"Using a heterologous expression system, we show that GPD1L associated with SCN5A and that the BrS- and SIDS related mutations in GPD1L caused a loss of enzymatic function resulting in glycerol-3-phosphate PKC dependent phosphorylation of SCN5A at serine 1503 (S1503) through a GPD1L dependent pathway."
GPD1L decreases the amount of SCN5A.
| 2
Mutated GPD1L decreases the amount of SCN5A. 1 / 1
| 1
reach
"A GPD1-L mutation decreases SCN5A surface membrane expression, reduces inward Na+ current, and causes Brugada syndrome."
Modified GPD1L-A280V decreases the amount of SCN5A. 1 / 1
| 1
reach
"Coexpression of A280V GPD1-L with SCN5A reduced SCN5A cell surface expression by 31 +/-5% (P = 0.01)."
GPD1L phosphorylates SCN5A.
| 1
GPD1L leads to the phosphorylation of SCN5A on S1503. 1 / 1
| 1
reach
"Using a heterologous expression system, we show that GPD1L associated with SCN5A and that the BrS- and SIDS related mutations in GPD1L caused a loss of enzymatic function resulting in glycerol-3-phosphate PKC dependent phosphorylation of SCN5A at serine 1503 (S1503) through a GPD1L dependent pathway."
GPD1L inhibits SCN5A.
| 1
GPD1L inhibits SCN5A. 1 / 1
| 1
reach
"Recently, a novel mutation in the glycerol-3-phosphate dehydrogenase 1 like gene (GPD1-L) disrupted trafficking of SCN5A in a multigenerational family with BrS."
GPD1L increases the amount of SCN5A.
| 1
Mutated GPD1L increases the amount of SCN5A. 1 / 1
| 1
reach
"By disrupting trafficking of SCN5A, GPD1-L mutations decrease SCN5A surface membrane expression and reduces I Na [XREF_BIBR]."
GPD1L dephosphorylates SCN5A.
| 1
GPD1L leads to the dephosphorylation of SCN5A on S1503. 1 / 1
| 1
reach
"Using a heterologous expression system, we show that GPD1L associated with SCN5A and that the BrS- and SIDS related mutations in GPD1L caused a loss of enzymatic function resulting in glycerol-3-phosphate PKC dependent phosphorylation of SCN5A at serine 1503 (S1503) through a GPD1L dependent pathway."
ELAVL1 affects SCN5A
| 5 4
ELAVL1 binds SCN5A.
| 5
| 5
sparser
"These data suggest that HuR specifically associates with SCN5A mRNA."
sparser
"HuR associated with SCN5A mRNA."
sparser
"The association of SCN5A mRNA with HuR was examined by PCR analyses following reverse transcription of RNA isolated from the IP precipitates using the procedure described before. xref SCN5A PCR products were highly enriched in samples precipitated with anti-HuR antibody, while no SCN5A PCR product was detected in control IgG pellets."
sparser
"The association of HuR and SCN5A mRNA protected SCN5A mRNA from decay."
sparser
"HuR was associated with SCN5A mRNA in cardiomyocytes, and the expression of HuR was downregulated in failing hearts."
ELAVL1 increases the amount of SCN5A.
| 3
Modified ELAVL1 increases the amount of SCN5A. 3 / 3
| 3
reach
"Our data indicated that HuR positively regulated MEF2C mRNA expression and that MEF2C enhanced cardiac sodium channel alpha subunit SCN5A mRNA expression, so it is of great interest to know whether overexpression of HuR increases the SCN5A mRNA expression."
reach
"Furthermore, overexpression of HuR also increased SCN5A mRNA expression, and this increase was attenuated by the presence of MEF2C siRNA without altering HuR expression."
reach
"Overexpression of HuR increased the expression of SCN5A mRNA, and this effect was attenuated by the presence of MEF2C small interfering RNA in cardiomyocytes."
ELAVL1 decreases the amount of SCN5A.
| 1
Modified ELAVL1 decreases the amount of SCN5A. 1 / 1
| 1
reach
"Overexpression of HuR may rescue decreased SCN5A expression and reduce arrhythmia risk in HF."
CAV3 affects SCN5A
1 | 3 5
CAV3 binds SCN5A.
1 | 3 3
1 | 1 2
reach
"The exact residues of association between Cav-3 and SCN5A are not yet known, but many other interaction sites on Cav-3 have been implicated in association with other signaling proteins such as adenylyl cyclase and beta adrenergic receptors reflecting its importance as a structural member of the SCCP Cav-3 appears to be important in mediating adrenergic upregulation of cardiac I Na through G proteins [XREF_BIBR]."
sparser
"Due to the complexity of signaling network in caveolar cardiac ion channels, we cannot exclude the possibilities that Cav3-F97C may disturb other signaling molecular complexes associated with Cav3 to have additional effects on SCN5A, or alter biophysical properties of other caveolar cardiac ion channels through specific signaling pathways to affect cellular electrophysiology."
biogrid
No evidence text available
reach
"We also performed immunoprecipitation with FLAG antibody using a FLAG tagged SCN5A co-expressed with nNOS, SNTA1, and Cav3 (WT, F97C, or vector) in HEK cells and found that the complex remained intact with the mutant Cav3 (XREF_SUPPLEMENTARY) Taken together, these results demonstrate that nNOS, SCN5A and SNTA1 form a complex with Cav3 in the heart."
SCN5A binds SNTA1, CAV3, and NOS1. 2 / 2
| 1 1
sparser
"To demonstrate interactions between SCN5A with SNTA1, nNOS and Cav3, co-IP experiments in rat heart homogenates were performed using nNOS antibody to immunoprecipitate the complex and specific antibodies to detect SCN5A, SNTA1, and Cav3 from the complex (F igure 3E )."
reach
"Cav3-F97C increased peak and late I Na by nNOS dependent S nitrosylation of SCN5A through the SCN5A, SNTA1, nNOS, and Cav3 complex."
| 1
sparser
"Mutations of SCN5A, CACNA1C and CAV3 are associated with ventricular tachycardia, long-QT syndromes (LQT3,8,9), and sudden cardiac death while mutations of HCN4 cause sick sinus syndrome type 2 xref ."
CAV3 inhibits SCN5A.
| 1
CAV3 inhibits SCN5A. 1 / 1
| 1
reach
"For instance, mutated Cav3 disrupts SCN5A function causing LQT3 and arrhythmias."
CAV3 activates SCN5A.
| 1
CAV3 activates SCN5A. 1 / 1
| 1
reach
"Caveolin-3 suppresses late sodium current by inhibiting nNOS dependent S nitrosylation of SCN5A."
Pyraclofos affects SCN5A
| 8
| 8
reach
"We first measured the voltage dependent activation of SkM1 and SCN5A current in GFP positive cells (XREF_FIG)."
reach
"This structure helps to set hH1 activation voltage to more depolarized potentials."
reach
"As mentioned above, mutations in three voltage gated sodium channel subunits cause Brugada syndrome, the cardiac alpha subunit SCN5A, and accessory subunits SCN1B and SCN3B."
reach
"To study voltage dependent activation of SkM1 and SCN5A currents in GFP positive cMSC (n = 8/group), cells were held at -100 mV to prevent inactivation, and then pulsed to test potentials from -80 to +40 mV, with 5 mV increments (XREF_FIG)."
reach
"These action potentials are initiated and propagated by a single isoform of voltage gated sodium channels - SCN5A."
reach
"Together, the data reveal a significant difference between hH1 and rSkM1 activation mechanisms.Is the shift in hH1 V a coupled to the removal of inactivation, or is the shift caused by some other phenomenon, such as a time dependent shift in V a or a second, independent effect of papain and alpha 1Ab on hH1 activation voltage?"
reach
"In addition to removing inactivation through the apparent clipping of the III-IV linker, it is quite possible that papain also cuts a second loop in hH1 and in hH1Q3 that imposes some structural (or perhaps electrostatic) effect on hH1 activation voltage that is unrelated to inactivation or to the III-IV linker."
reach
"This suggests that some channel segment within, near, or interacting with the III-IV linker is involved in establishing hH1 activation voltage."
SCN5A affects HB1
| 8
SCN5A binds HB1. 5 / 5
| 5
sparser
"The data showed that these complexes were bound by HB1 and HB2 from RLPM, and to the 110-kDa HDL binding protein from BAECM, providing critical evidence to support the model."
sparser
"To assess the role of hydrogen bonding with solvent in lowering the energy difference, we calculated the three-dimensional adiabatic potential energy surface of the TIM/solvent model in the hydrogen bond space involving the two hb1 and hb2 interactions."
sparser
"Specifically, as seen in Fig. 3 , which shows the closed and open minimized structures in solvent, three water molecules are able to compensate for the loss of the two hb1 and hb2 interactions: one forms a hydrogen bond with the Ser 211 hydroxyl oxygen, one with the Ala 176 amide nitrogen, and one with the Thr 172 hydroxyl oxygen."
sparser
"The effect of the two Abs combined on '251-HDL binding was not additive, i.e. a mixture of both Abs (1:1, w/w) was as effective as each of them alone [Fig. 2(A)], which may suggest an association of HB1 and HB2 in cell membranes."
sparser
"Analysis of the intra- and interloop energies points to a hydrogen bond energy loss of 10 kcal/mol in going from the closed to open forms, associated with the breaking of the two hb1 and hb2 interactions. (Each hydrogen bond energy was calculated from the nonbonded interactions between the corresponding residues.) This suggests that if the open conformation can compensate for the loss of the two intramolecular hydrogen bonds by intermolecular hydrogen bonds (either with solvent or with the second monomer), the energy difference could be lowered to 15 kcal/mol."
HDL binds SCN5A and HB1. 2 / 2
| 2
sparser
"DMPC associated specifically with HB1 and HB2, two HDL binding proteins recently identified in rat liver plasma membranes."
sparser
"These results support the findings of a previous study showing that HDL binding activity of both HB1 and HB2, which was determined by ligand blotting using HDL3 as a ligand, were reduced after administering cholesterol lowering agents. (Arteriosclerosis, 10: 1045-1050,1990)."
SCN5A binds MTRNR2L1 and HB1. 1 / 1
| 1
sparser
"HB1, HB2, and HB3 are formed by HN1, HN2, and HN3 with one F – anion with the atomic distance of 1.58, 1.40, and 1.58 Å, respectively, in the gas phase."
SCN5A affects DCM
| 5 3
SCN5A binds DCM.
| 5
SCN5A binds DCM. 2 / 2
| 2
sparser
"Several other SCN5A mutations associated with familial DCM-arrhythmia syndrome have also been described (R814W, D1275N, T220I, and D1595H) ( 10–12 )."
sparser
"In addition to arrhythmias, SCN5A mutations have been associated with cardiomyopathy. xref – xref To date, 12 rare variants in SCN5A have been identified in cardiomyopathy and all of the variants have also been associated with arrhythmia phenotypes that result from loss of sodium channel function. xref – xref In our mouse model, the loss of sodium channel function by D1275N is consistent with biophysical properties of other SCN5A mutations associated with DCM, xref , xref , xref and findings in clinical and experimental studies suggest that marked reduction of sodium current is critical for development of cardiomyopathy. xref , xref , xref , xref In prior studies, mice with 90% reduction of Scn5a expression level develop cardiac dysfunction, xref while heterozygous Scn5a knockdown mice ( Scn5a +/− ) display normal cardiac function. xref In our study, mice expressing D1275N, one of the initially reported SCN5A mutations in a cardiomyopathy kindred, xref , xref showed reduction of sodium current with disrupted channel gating and developed evident cardiomyopathy at 12 weeks."
SCN5A binds FLNC and DCM. 1 / 1
| 1
sparser
"Mutations in the DCM genes, SCN5A and FLNC , are also associated with higher rates of arrhythmias. xref , xref These specific arrhythmia associations with pathogenic mutations in LMNA , RBM20 , SCN5A , or FLNC are of urgent importance, and genetic evaluation should be standard of care for DCM patients to better delineate this risk."
SCN5A binds LMNA and DCM. 1 / 1
| 1
sparser
"For example, mutations in LMNA and SCN5A have been associated with a cardiac syndrome of DCM, impaired automaticity and conduction, and atrial fibrillation ( xref – xref )."
SCN5A binds PSMD4, TPS-sab, bop, and DCM. 1 / 1
| 1
sparser
"Since then, mutations in all domains of SCN5A have been associated with LQTS, BrS [1], PFHB [ xref ], SSS [ xref ], DCM [ xref ] and l-AF [ xref ]."
SCN5A activates DCM.
| 3
SCN5A-R222Q activates DCM. 1 / 1
| 1
reach
"DCM caused by the SCN5A R222Q mutation, seems to be a secondary finding to ventricular arrhythmia, of note we have not observed myocardial muscle thinning in the course of the disease, like in our patient (LV wall thickness was 12-13mm)."
SCN5A activates DCM. 1 / 1
| 1
reach
"The DCM caused by mutations in both SCN5A and ABCC9 is accompanied by cardiac arrhythmia."
Mutated SCN5A activates DCM. 1 / 1
| 1
reach
"The pathophysiology of DCM caused by SCN5A mutations still remains unclear."
SCN5A affects CAV3
1 | 3 4
SCN5A binds CAV3.
1 | 3 3
1 | 1 2
reach
"The exact residues of association between Cav-3 and SCN5A are not yet known, but many other interaction sites on Cav-3 have been implicated in association with other signaling proteins such as adenylyl cyclase and beta adrenergic receptors reflecting its importance as a structural member of the SCCP Cav-3 appears to be important in mediating adrenergic upregulation of cardiac I Na through G proteins [XREF_BIBR]."
sparser
"Due to the complexity of signaling network in caveolar cardiac ion channels, we cannot exclude the possibilities that Cav3-F97C may disturb other signaling molecular complexes associated with Cav3 to have additional effects on SCN5A, or alter biophysical properties of other caveolar cardiac ion channels through specific signaling pathways to affect cellular electrophysiology."
biogrid
No evidence text available
reach
"We also performed immunoprecipitation with FLAG antibody using a FLAG tagged SCN5A co-expressed with nNOS, SNTA1, and Cav3 (WT, F97C, or vector) in HEK cells and found that the complex remained intact with the mutant Cav3 (XREF_SUPPLEMENTARY) Taken together, these results demonstrate that nNOS, SCN5A and SNTA1 form a complex with Cav3 in the heart."
SCN5A binds SNTA1, CAV3, and NOS1. 2 / 2
| 1 1
sparser
"To demonstrate interactions between SCN5A with SNTA1, nNOS and Cav3, co-IP experiments in rat heart homogenates were performed using nNOS antibody to immunoprecipitate the complex and specific antibodies to detect SCN5A, SNTA1, and Cav3 from the complex (F igure 3E )."
reach
"Cav3-F97C increased peak and late I Na by nNOS dependent S nitrosylation of SCN5A through the SCN5A, SNTA1, nNOS, and Cav3 complex."
| 1
sparser
"Mutations of SCN5A, CACNA1C and CAV3 are associated with ventricular tachycardia, long-QT syndromes (LQT3,8,9), and sudden cardiac death while mutations of HCN4 cause sick sinus syndrome type 2 xref ."
SCN5A activates CAV3.
| 1
SCN5A activates mutated CAV3. 1 / 1
| 1
reach
"This increase in late I Na is comparable with the increases observed for previously identified LQTS causing CAV3 mutations and for both LQT3 causing and SIDS associated mutations in SCN5A."
SCN5A affects Ala-Pro
| 8
SCN5A activates Ala-Pro.
| 5
SCN5A activates Ala-Pro. 4 / 4
| 4
reach
"Loss of function mutations in SCN5A leads to reduced I Na during the AP, causing a reduction in the doming of the AP."
reach
"In contrast, expression of SCN5A did not increase the AP upstrokes at these membrane potentials."
reach
"SCN5A inactivation defects underlie AP prolongation in LQT3 via gain of function, producing a persistent component of INa termed late current, or INaL."
reach
"Mechanism : The basic defect in LQT3 or LQTS-type-3 - which is the third most common LQTS - is caused by an excessive inflow of late Na + current during the plateau, dome or phase 2 of the AP caused by gain-of-function mutations in the SCN5A cardiac Na + channel gene which mediates the fast Nav1.5 current during AP initiation and also late in phase 2 of AP causing an accelerated recovery from inactivation of Na + current as well as AP prolongation, especially at low stimulation rates."
Mutated SCN5A activates Ala-Pro. 1 / 1
| 1
reach
"SCN5A mutation induces heterogeneous AP change in the epicardium and phase 2 reentry in both the right and left ventricles.Some investigators have proposed idiopathic VF with prominent J-wave syndrome or early repolarization."
SCN5A inhibits Ala-Pro.
| 3
| 3
reach
"However, mutations in SCN5A connected with loss-of-function of sodium channel cause Brugada syndrome (BrS) characterized by decreased peak in I Na and reduced upstroke velocity of the AP."
reach
"AP conduction velocity magnitudes derived by averaging MEA results from local vector analyses, CV *, were reduced by the Scn5a +/- genotype alone."
reach
"Finally, the severely affected Scn5a +/- mice had similar Na v 1.5 mRNA but lower Na v 1.5 protein expression, moderately smaller Na + currents, and reduced AP upstroke velocities than the mildly affected Scn5a +/- mice."
PKC affects SCN5A
| 2 6
PKC phosphorylates SCN5A.
| 2 3
PKC phosphorylates SCN5A. 4 / 4
| 1 3
reach
"GPD1L links redox state to cardiac excitability by PKC dependent phosphorylation of the sodium channel SCN5A."
reach
"Mutations causing loss of function of this enzyme, in turn, cause increased levels of glycerol-3-phosphate, promoting the protein kinase C dependent phosphorylation of the SCN5A."
reach
"They demonstrated association of GPD1L with SCN5A; mutants of GPD1L increased PKC mediated phosphorylation of SCN5A which in turn causes a dysfunction in sodium current, a mechanism for ventricular arrhythmias."
sparser
"Mutations causing loss of function of this enzyme, in turn, cause increased levels of glycerol-3-phosphate, promoting the protein kinase C-dependent phosphorylation of the SCN5A.[ xref ]"
PKC phosphorylates SCN5A on S1503. 1 / 1
| 1
sparser
"Using a heterologous expression system, we show that GPD1L associated with SCN5A and that the BrS- and SIDS-related mutations in GPD1L caused a loss of enzymatic function resulting in glycerol-3-phosphate PKC-dependent phosphorylation of SCN5A at serine 1503 (S1503) through a GPD1L-dependent pathway."
PKC activates SCN5A.
| 2
PKC activates SCN5A. 2 / 2
| 2
reach
"Taken together, these results with Tx are similar to those obtained previously with phorbol ester application and alpha-adrenergic receptor stimulation [7], suggesting that PKC modulates hH1 current by activating cPKC isoforms.To further confirm this hypothesis, additional experiments were performed using inhibitors of PKC."
reach
"In this study, we tested the hypothesis that PKC activation acutely modulates the intracellular distribution of SCN5A channels and that this effect can be visualized in living cells."
PKC decreases the amount of SCN5A.
| 1
PKC decreases the amount of SCN5A. 1 / 1
| 1
reach
"Moreover, they found that PKC activation acutely decreases the surface expression of SCN5A and this effect is prevented by the NADPH oxidase inhibitor apocynin, suggesting that both channel phosphorylation and reactive oxygen species production are required for PKC mediated regulation of SCN5A trafficking."
LUC7L3 affects SCN5A
| 8
LUC7L3 activates SCN5A.
| 6
LUC7L3 activates SCN5A. 5 / 5
| 5
reach
"The splicing factors RBM25 and LUC7L3 are elevated in human heart failure tissue and mediate truncation of SCN5A mRNA in both Jurkat cells and human embryonic stem cell derived cardiomyocytes [XREF_BIBR]."
reach
"LUC7L3 and RBM25 were elevated in human HF tissue and mediated abnormal SCN5A splicing regulation in the two cell types tested."
reach
"The activated RMB25 and LUC7L3 splicing complex increases SCN5A C (VC) and D (VD) variants, decreases the full-length SCN5A transcript and protein, and decreases Na + current."
reach
"Two of these splicing factors, RBM25 and LUC7L3, were elevated in human heart failure tissue and mediated truncation of SCN5A mRNA in both Jurkat cells and human embryonic stem cell derived cardiomyocytes."
reach
"Finally, while experimental manipulations of RBM25 and LUC7L3 were sufficient to cause or prevent SCN5A mRNA dysregulation, it remains possible that some of the other splicing factors increased in HF contribute to abnormal SCN5A splicing."
LUC7L3 bound to RBM25 activates SCN5A. 1 / 1
| 1
reach
"XREF_BIBR, XREF_BIBR Here, we tested whether the RBM25 and LUC7L3 complex mediates pathological SCN5A mRNA splicing in HF."
LUC7L3 inhibits SCN5A.
| 2
LUC7L3 inhibits SCN5A. 2 / 2
| 2
reach
"The activated RMB25 and LUC7L3 splicing complex increases SCN5A C (VC) and D (VD) variants, decreases the full-length SCN5A transcript and protein, and decreases Na + current."
reach
"While downregulation of the two splicing factors in Jurkat cells reduced the SCN5A variants E28C and E28D, overexpression of RBM25 and LUC7L3 increased E28C and E28D and decreased the full length SCN5A mRNA abundances."
HB1 affects SCN5A
| 8
SCN5A binds HB1. 5 / 5
| 5
sparser
"The data showed that these complexes were bound by HB1 and HB2 from RLPM, and to the 110-kDa HDL binding protein from BAECM, providing critical evidence to support the model."
sparser
"To assess the role of hydrogen bonding with solvent in lowering the energy difference, we calculated the three-dimensional adiabatic potential energy surface of the TIM/solvent model in the hydrogen bond space involving the two hb1 and hb2 interactions."
sparser
"Specifically, as seen in Fig. 3 , which shows the closed and open minimized structures in solvent, three water molecules are able to compensate for the loss of the two hb1 and hb2 interactions: one forms a hydrogen bond with the Ser 211 hydroxyl oxygen, one with the Ala 176 amide nitrogen, and one with the Thr 172 hydroxyl oxygen."
sparser
"The effect of the two Abs combined on '251-HDL binding was not additive, i.e. a mixture of both Abs (1:1, w/w) was as effective as each of them alone [Fig. 2(A)], which may suggest an association of HB1 and HB2 in cell membranes."
sparser
"Analysis of the intra- and interloop energies points to a hydrogen bond energy loss of 10 kcal/mol in going from the closed to open forms, associated with the breaking of the two hb1 and hb2 interactions. (Each hydrogen bond energy was calculated from the nonbonded interactions between the corresponding residues.) This suggests that if the open conformation can compensate for the loss of the two intramolecular hydrogen bonds by intermolecular hydrogen bonds (either with solvent or with the second monomer), the energy difference could be lowered to 15 kcal/mol."
HDL binds SCN5A and HB1. 2 / 2
| 2
sparser
"DMPC associated specifically with HB1 and HB2, two HDL binding proteins recently identified in rat liver plasma membranes."
sparser
"These results support the findings of a previous study showing that HDL binding activity of both HB1 and HB2, which was determined by ligand blotting using HDL3 as a ligand, were reduced after administering cholesterol lowering agents. (Arteriosclerosis, 10: 1045-1050,1990)."
SCN5A binds MTRNR2L1 and HB1. 1 / 1
| 1
sparser
"HB1, HB2, and HB3 are formed by HN1, HN2, and HN3 with one F – anion with the atomic distance of 1.58, 1.40, and 1.58 Å, respectively, in the gas phase."
AGT affects SCN5A
| 8
AGT activates SCN5A.
| 4
AGT activates SCN5A. 4 / 4
| 4
reach
"The results indicated that AngII mediated SCN5A mRNA downregulation was dependent on PERK (XREF_FIG)."
reach
"The results indicated that Ang II mediated SCN5A downregulation was dependent on the splicing factor RBM25 (XREF_FIG)."
reach
"Previous studies show that ANG II exposure led to downregulation of T-box5, a transcription factor critical for proper heart development, and Scn5a, the gene that encodes for cardiac sodium channel Na V 1.5, relative to control tissues."
reach
"While Ang II and hypoxia were sufficient to signal SCN5A abnormal splicing, there could be other heart failure associated factors that could contribute to SCN5A downregulation in vivo."
AGT decreases the amount of SCN5A.
| 3
AGT decreases the amount of SCN5A. 3 / 3
| 3
reach
"11 Ang II can also decrease SCN5A transcription and current through production of H 2 O 2 resulting in nuclear factor kappa B (NF-kappaB) binding to the sodium channel promoter."
reach
"Moreover, NF-kappaB has been implicated in the Ang II induced decrease of SCN5A transcription and sodium current."
reach
"In conclusion, ANG II can decrease scn5a transcription and current."
AGT inhibits SCN5A.
| 1
AGT inhibits SCN5A. 1 / 1
| 1
reach
"siRNAs for these two splicing factors were found to block partially the increases in the hypoxia or Ang II induced SCN5A variants E28C and E28D at 48 h (XREF_FIG)."
SCN5A affects BrS
| 7
SCN5A activates BrS.
| 5
SCN5A activates BrS. 4 / 4
| 4
reach
"BrS is caused, in part, by mutations in the SCN5A gene, which encodes the sodium channel alpha-subunit Na (v) 1.5."
reach
"XREF_BIBR SCN5A mediated BrS (BrS1) represents the most common genetic subtype and loss-of-function mutations in the SCN5A encoded NaV1.5 sodium channel, accounting for approximately 20% of BrS."
reach
"SCN5A mediated BrS (BrS1) is still the only common genetic substrate for BrS in general, particularly for young BrS males (< 20 years) and those BrS patients with a PQ interval> = 200ms who may have a 40 - 50% pre-test probability for a positive SCN5A genetic test result."
reach
"In the majority of patients, BrS is caused by mutations in the cardiac sodium channel gene SCN5A, which encodes the alpha-subunit of the sodium channel."
Mutated SCN5A activates BrS. 1 / 1
| 1
reach
"For instance, SCN5A mutations can cause not only LQT3 and BrS, but also cardiac conduction disease, sick sinus syndrome, atrial fibrillation, or dilated cardiomyopathy."
SCN5A inhibits BrS.
| 2
Mutated SCN5A inhibits BrS. 1 / 1
| 1
reach
"suggesting that, in some cases, loss-of-function SCN5A mutation might not be sufficient to cause BrS but could act as a predisposing or a modulating factor."
SCN5A inhibits BrS. 1 / 1
| 1
reach
"This might point to the fact that loss-of-function mutations in SCN5A and GPD1L might not be sufficient to cause BrS but could act like a revelatory factor such as a sodium channel blocker challenge."
NFkappaB affects SCN5A
| 3 4
NFkappaB binds SCN5A.
| 3 1
| 3 1
sparser
"Elevated angiotensin II levels and the increased oxidative stress increase NF-κB binding to the SCN5A promoter region, thereby decreasing its transcriptional activity (Shang et al., xref )."
reach
"Angiotensin II (AngII) or H 2 O 2 treatment of cardiomyocytes results in increased NF-kappaB binding to SCN5A promoter with subsequent reduction in transcriptional activity [XREF_BIBR]."
sparser
"Angiotensin II (AngII) or H 2 O 2 treatment of cardiomyocytes results in increased NF-κB binding to SCN5A promoter with subsequent reduction in transcriptional activity [ xref ]."
sparser
"This is in agreement with another study xref that demonstrated that NFκB can directly bind to the SCN5A promoter, which is involved in down-transcription of the Na v 1.5 channel in rat ventricular cells."
NFkappaB inhibits SCN5A.
| 1
| 1
reach
"Both NF-kappaB and FoxO1 suppress SCN5a promoter activity, leading to the down-regulation of Na V 1.5 expression [XREF_BIBR, XREF_BIBR], indicating that these two signaling pathways play important roles in the regulation of Na + channel activity in heart diseases."
NFkappaB decreases the amount of SCN5A.
| 1
NFkappaB decreases the amount of SCN5A. 1 / 1
| 1
reach
"11 Ang II can also decrease SCN5A transcription and current through production of H 2 O 2 resulting in nuclear factor kappa B (NF-kappaB) binding to the sodium channel promoter."
NFkappaB activates SCN5A.
| 1
NFkappaB activates mutated SCN5A. 1 / 1
| 1
reach
"Mutation of the scn5a promoter NF-kappaB binding site prevented decreased activity in response to ANG II and H (2) O (2)."
Lqh III affects SCN5A
| 7
Lqh III binds SCN5A.
| 4
| 4
reach
"Strong Interaction between hH1 and Lqh III."
reach
"Compared with the results obtained for the other two toxins and also for the toxin interaction with muI sodium channels (Chen et al. 2000), the interaction between hH1 and Lqh III shows unusual properties."
reach
"However, the dissociation rate of Lqh III from hH1 channels was much slower than that from muI channels (at +100 mV, tau off = 2,010 vs. 322 ms), suggesting that Lqh III binds to hH1 channels most strongly and the interaction between the hH1 channel and Lqh III is unusual."
reach
"With this study, we intended to evaluate the effect of Lqh III on slow inactivation of hH1 channels, as we found that Lqh III binds to hH1 channels so tightly such that strong depolarizations, which are needed to induce slow inactivation, can not completely dissociate Lqh III from these channels."
Lqh III inhibits SCN5A.
| 2
| 2
reach
"Although under control conditions hH1 channels inactivate rapidly and completely, Lqh II and Lqh III at that low concentration strongly slowed down fast inactivation of hH1 channels."
reach
"As shown in XREF_FIG XREF_FIG XREF_FIG, Lqh II and Lqh III enhance slow inactivation of hH1 and muI channels."
Lqh III activates SCN5A.
| 1
Lqh III activates SCN5A. 1 / 1
| 1
reach
"XREF_FIG A shows that Lqh III accelerated the development of slow inactivation and increased the fraction of hH1 channels that entered slow inactivation."
DCM affects SCN5A
| 5 2
DCM binds SCN5A.
| 5
SCN5A binds DCM. 2 / 2
| 2
sparser
"Several other SCN5A mutations associated with familial DCM-arrhythmia syndrome have also been described (R814W, D1275N, T220I, and D1595H) ( 10–12 )."
sparser
"In addition to arrhythmias, SCN5A mutations have been associated with cardiomyopathy. xref – xref To date, 12 rare variants in SCN5A have been identified in cardiomyopathy and all of the variants have also been associated with arrhythmia phenotypes that result from loss of sodium channel function. xref – xref In our mouse model, the loss of sodium channel function by D1275N is consistent with biophysical properties of other SCN5A mutations associated with DCM, xref , xref , xref and findings in clinical and experimental studies suggest that marked reduction of sodium current is critical for development of cardiomyopathy. xref , xref , xref , xref In prior studies, mice with 90% reduction of Scn5a expression level develop cardiac dysfunction, xref while heterozygous Scn5a knockdown mice ( Scn5a +/− ) display normal cardiac function. xref In our study, mice expressing D1275N, one of the initially reported SCN5A mutations in a cardiomyopathy kindred, xref , xref showed reduction of sodium current with disrupted channel gating and developed evident cardiomyopathy at 12 weeks."
SCN5A binds FLNC and DCM. 1 / 1
| 1
sparser
"Mutations in the DCM genes, SCN5A and FLNC , are also associated with higher rates of arrhythmias. xref , xref These specific arrhythmia associations with pathogenic mutations in LMNA , RBM20 , SCN5A , or FLNC are of urgent importance, and genetic evaluation should be standard of care for DCM patients to better delineate this risk."
SCN5A binds LMNA and DCM. 1 / 1
| 1
sparser
"For example, mutations in LMNA and SCN5A have been associated with a cardiac syndrome of DCM, impaired automaticity and conduction, and atrial fibrillation ( xref – xref )."
SCN5A binds PSMD4, TPS-sab, bop, and DCM. 1 / 1
| 1
sparser
"Since then, mutations in all domains of SCN5A have been associated with LQTS, BrS [1], PFHB [ xref ], SSS [ xref ], DCM [ xref ] and l-AF [ xref ]."
DCM inhibits SCN5A.
| 1
DCM inhibits SCN5A. 1 / 1
| 1
reach
"We show that the DCM related SCN5A rare variants perturb the SCN5A biophysical phenotype that is modulated by SCN5A common variants."
DCM activates SCN5A.
| 1
DCM activates SCN5A. 1 / 1
| 1
reach
"Gain-of-function effects on I Na have been seen with some DCM causing SCN5A variants, including the R814W variant, which increases window current (26), analogous to our findings with R222Q."
Type 3 affects SCN5A
| 6
SCN5A binds type 3. 4 / 4
| 4
sparser
"However, sinus node dysfunction has also been reported in patients with gain-of-function SCN5A mutations associated with long QT syndrome type 3 (LQT3) in apparent overlap with the previous examples ( xref )."
sparser
"SCN5A mutations associated with long QT syndrome type 3 (LQT3) lead to enhanced late sodium current and consequent action potential (AP) prolongation."
sparser
"Type 3 LQTS (LQT3) is associated with mutations in the SCN5A gene, which codes for the Na + voltage-gated channel. xref "
sparser
"Long QT syndrome type 3 (LQT3) is associated with genetic modifications of the Scn5a gene, which interfere with Na + channel inactivation and lead to persistent, arrhythmogenic late Na + currents ( xref )."
RYR2 binds SCN5A, NTRK3, bop, and type 3. 2 / 2
| 2
sparser
"The four core genes causing IPAS are KCNQ1 associated with long QT syndrome type 1 (LQTS1), KCNH2 associated with long QT syndrome type 2 (LQTS2), SCN5A associated with long QT syndrome type 3 (LQTS3) or BrS and RYR2 associated with CPVT."
sparser
"The four core genes causing IPAS are KCNQ1 associated with long QT syndrome type 1 (LQTS1), KCNH2 associated with long QT syndrome type 2 (LQTS2), SCN5A associated with long QT syndrome type 3 (LQTS3) or BrS and RYR2 associated with CPVT."
SCN5A affects pyraclofos
| 6
SCN5A activates pyraclofos.
| 5
| 5
reach
"In addition to removing inactivation through the apparent clipping of the III-IV linker, it is quite possible that papain also cuts a second loop in hH1 and in hH1Q3 that imposes some structural (or perhaps electrostatic) effect on hH1 activation voltage that is unrelated to inactivation or to the III-IV linker."
reach
"This structure helps to set hH1 activation voltage to more depolarized potentials."
reach
"This suggests that some channel segment within, near, or interacting with the III-IV linker is involved in establishing hH1 activation voltage."
reach
"Together, the data reveal a significant difference between hH1 and rSkM1 activation mechanisms.Is the shift in hH1 V a coupled to the removal of inactivation, or is the shift caused by some other phenomenon, such as a time dependent shift in V a or a second, independent effect of papain and alpha 1Ab on hH1 activation voltage?"
reach
"Coexpression of hH1 with beta 1 accelerates time constants in the middle voltage range."
SCN5A inhibits pyraclofos.
| 1
| 1
reach
"Mutations in the Na v 1.5-encoding SCN5A gene account for> 75% of BrS genotype positive cases, although the yield of SCN5A testing for clinical cases is only = ~ 25% to 30%.5 In the presence of the previously described changes in ion currents, particularly I Na reduction, the net repolarizing effect of I to during phase 1 is significantly enhanced, thus reducing cell voltage to values below those required to activate L-type Ca ++ channels."
SCN5A affects RBM25
| 2 4
| 2 4
reach
"Our results show that angiotensin II and hypoxia, signals common to HF, result in increased LUC7L3 and RBM25 splicing regulators, increased binding of RBM25 to SCN5A mRNA, increased SCN5A splice variant abundances, decreased full-length SCN5A mRNA and protein, and decreased Na (+) current."
sparser
"Our results shows that AngII and hypoxia, signals common to HF, result in increased LUC7L3 and RBM25 splicing regulators, increased binding of RBM25 to SCN5A mRNA, increased SCN5A splice variant abundances, decreased full-length SCN5A mRNA and protein, and decreased Na + current."
sparser
"In summary, AngII and hypoxia, signals common to HF, result in increased hLuc7A and RBM25 protein, increased binding of RBM25 to SCN5A mRNA, increased SCN5A splice variant abundances, decreased full-length SCN5A mRNA and protein, and decreased Na + current."
reach
"RBM25 was bound to the wild-type SCN5A sequence in a concentration dependent manner (XREF_FIG)."
reach
"In summary, AngII and hypoxia, signals common to HF, result in increased hLuc7A and RBM25 protein, increased binding of RBM25 to SCN5A mRNA, increased SCN5A splice variant abundances, decreased full-length SCN5A mRNA and protein, and decreased Na + current."
reach
"Our results shows that AngII and hypoxia, signals common to HF, result in increased LUC7L3 and RBM25 splicing regulators, increased binding of RBM25 to SCN5A mRNA, increased SCN5A splice variant abundances, decreased full-length SCN5A mRNA and protein, and decreased Na + current."
SCN5A affects FOXO1
| 3 3
SCN5A binds FOXO1.
| 3 2
| 3 2
sparser
"To confirm the association of Foxo1 with the SCN5a promoter region including IREs, a ChIP assay was carried out in HL-1 cells and mouse ventricular myocytes, and it unveiled a clear enrichment of DNA amplified by PCR with two sets of primer pairs flanking Foxo1 binding IREs ( 5′-CAAAACAAAACA-3′ ) in the proximal SCN5a promoter region following immunoprecipitation with Foxo1 antibody, but not with IgG control ( xref )."
reach
"Foxo1 binds the promoter region of SCN5A [XREF_BIBR], and exogenous Foxo1 expression decreases SCN5A promoter activity in HL-1 cells [XREF_BIBR]."
reach
"Foxo1 directly binds SCN5a promoter."
sparser
"Foxo1 directly binds SCN5a promoter."
sparser
"Foxo1 binds the promoter region of SCN5A [ xref ], and exogenous Foxo1 expression decreases SCN5A promoter activity in HL-1 cells [ xref ]."
SCN5A increases the amount of FOXO1.
| 1
SCN5A increases the amount of FOXO1. 1 / 1
| 1
reach
"XREF_BIBR - XREF_BIBR A recent study has indicated that FOXO1 negatively regulates SCN5A transcription, XREF_BIBR and effect that can be inhibited by Akt induced phosphorylation and translocation of FOXO1 from the nucleus to the cytoplasm."
CTNNB1 affects SCN5A
| 6
CTNNB1 inhibits SCN5A. 6 / 6
| 6
reach
"3.7 TCF4 was required for beta-catenin inhibition of SCN5a promoter activity."
reach
"The results revealed that both beta-catenin overexpression and LiCl significantly inhibited the SCN5a promoter activity as compared to the control (p < 0.01) (XREF_FIG)."
reach
"TCF4 SiRNA was used to confirm that beta-catenin inhibition of SCN5a promoter activity requires TCF4."
reach
"However, the SCN5a promoter activity was significantly increased (p < 0.01) by TCF4 siRNA in the presence of beta-catenin, indicating that beta-catenin inhibition of SCN5a promoter activity is dependent on the presence of TCF4 (XREF_FIG)."
reach
"Beta-catenin inhibition of SCN5a promoter activity was in a concentration dependent manner (XREF_FIG)."
reach
"Luciferase promoter assays exhibited that beta-catenin inhibited the SCN5a promoter activity at a dose dependent manner and this inhibition required TCF4."
CAMK2D affects SCN5A
2 4 |
CAMK2D phosphorylates SCN5A.
2 2 |
CAMK2D phosphorylates SCN5A on S516. 2 / 2
1 1 |
signor
"A stable interaction between ?(C)-camkii and the intracellular loop between domains 1 and 2 of na(v)1.5 was observed. This region was also phosphorylated by ?(C)-camkii, specifically at the ser-516 and thr-594 sites.Wild-type (wt) and phosphomutant hna(v)1.5 were co-expressed with gfp-?(C)-camkii in hek293 cells, and i(na) was recorded. As observed in myocytes, camkii shifted wt i(na) availability to a more negative membrane potential and enhanced accumulation of i(na) into an intermediate inactivated state, but these effects were abolished by mutating either of these sites to non-phosphorylatable ala residues."
biopax:phosphositeplus
No evidence text available
CAMK2D phosphorylates SCN5A on T594. 2 / 2
1 1 |
signor
"A stable interaction between ?(C)-camkii and the intracellular loop between domains 1 and 2 of na(v)1.5 was observed. This region was also phosphorylated by ?(C)-camkii, specifically at the ser-516 and thr-594 sites.Wild-type (wt) and phosphomutant hna(v)1.5 were co-expressed with gfp-?(C)-camkii in hek293 cells, and i(na) was recorded. As observed in myocytes, camkii shifted wt i(na) availability to a more negative membrane potential and enhanced accumulation of i(na) into an intermediate inactivated state, but these effects were abolished by mutating either of these sites to non-phosphorylatable ala residues."
biopax:phosphositeplus
No evidence text available
CAMK2D inhibits SCN5A.
2 |
CAMK2D inhibits SCN5A. 2 / 2
2 |
signor
"A stable interaction between ?(C)-camkii and the intracellular loop between domains 1 and 2 of na(v)1.5 was observed. This region was also phosphorylated by ?(C)-camkii, specifically at the ser-516 and thr-594 sites.Wild-type (wt) and phosphomutant hna(v)1.5 were co-expressed with gfp-?(C)-camkii in hek293 cells, and i(na) was recorded. As observed in myocytes, camkii shifted wt i(na) availability to a more negative membrane potential and enhanced accumulation of i(na) into an intermediate inactivated state, but these effects were abolished by mutating either of these sites to non-phosphorylatable ala residues."
signor
"A stable interaction between ?(C)-camkii and the intracellular loop between domains 1 and 2 of na(v)1.5 was observed. This region was also phosphorylated by ?(C)-camkii, specifically at the ser-516 and thr-594 sites.Wild-type (wt) and phosphomutant hna(v)1.5 were co-expressed with gfp-?(C)-camkii in hek293 cells, and i(na) was recorded. As observed in myocytes, camkii shifted wt i(na) availability to a more negative membrane potential and enhanced accumulation of i(na) into an intermediate inactivated state, but these effects were abolished by mutating either of these sites to non-phosphorylatable ala residues."
Sodium(1+) affects SCN5A
| 5
Sodium(1+) inhibits SCN5A.
| 1
Sodium(1+) inhibits mutated SCN5A. 1 / 1
| 1
reach
"Consequently, the pharmacological blocker of sodium current, mexiletine, shortens the QTc interval and rescues the defect of the SCN5A mutation."
Sodium(1+) increases the amount of SCN5A.
| 1
Sodium(1+) increases the amount of SCN5A. 1 / 1
| 1
reach
"25 Recently, the SCN10A gene, a neuronal sodium channel gene encoding Nav1.8, has also been found to modulate SCN5A expression and the electrical function of the heart, 26 and pathogenic variants of the GPD1-L gene have been implicated in reducing both the surface membrane expression and the inward sodium current."
Sodium(1+) decreases the amount of SCN5A.
| 1
Sodium(1+) decreases the amount of SCN5A. 1 / 1
| 1
reach
"The authors demonstrated that a single nucleotide polymorphism present in a conserved Tbx3 and Tbx5 bound enhancer of Scn5a, a sodium channel that is essential for rapid cardiomyocyte depolarization, reduced Tbx3 and Tbx5 binding affinity and, consequently, altered Scn5a expression."
Sodium(1+) binds SCN5A.
| 1
Sodium(1+) binds SCN5A-S1103Y. 1 / 1
| 1
reach
"A common cardiac sodium channel variant associated with sudden infant death in African Americans, SCN5A S1103Y."
Sodium(1+) activates SCN5A.
| 1
| 1
reach
"LQTS type 3, caused by gain-of-function mutations in the sodium ion channel encoding gene SCN5A, was also recapitulated in iPSC-CMs by decreased voltage dependent inactivation of sodium channels."
Lidocaine affects SCN5A
| 5
Lidocaine inhibits SCN5A.
| 3
| 3
reach
"When expressed in Xenopus oocytes, lidocaine block of hH1 (human cardiac) Na current greatly exceeded that of mu1 (rat skeletal muscle) at membrane potentials near V (rest), whereas hyperpolarization to -140 mV equalized block of the two isoforms."
reach
"The concentration dependence of the lidocaine block of hH1 Na current was consistent with a binding stoichiometry of 1:1."
reach
"In contrast, lidocaine markedly reduced hH1 I Na after a prepulse to -100 mV."
Lidocaine binds SCN5A.
| 2
Lidocaine binds mutated SCN5A. 1 / 1
| 1
reach
"4,22 None of these SCN5A mutations have been associated with lidocaine induced arrhythmia."
reach
"A Rare Loss-of-Function SCN5A Variant is Associated With Lidocaine induced Ventricular Fibrillation."
BetA1 affects SCN5A
| 5
BetA1 binds SCN5A.
| 2
| 2
reach
"These results indicate that hH1 and the b2 subunit are transported separately to the plasma membrane whereas the hH1 and beta1 complex occurs already within the ER, which possibly facilitates trafficking of the channel complex to the plasma membrane."
reach
"A study using over-expression of fluorescent tagged SCN5A, beta1, and beta2 in HEK293 cells suggested that SCN5A and beta2 are transported separately to the plasma membrane while SCN5A and beta1 form a complex in the endoplasmic reticulum (ER) that may facilitate plasma membrane trafficking XREF_BIBR."
BetA1 activates SCN5A.
| 2
BetA1 activates SCN5A. 2 / 2
| 2
reach
"XREF_BIBR Some groups have reported that beta1 increases SCN5A currents without affecting the voltage dependence of gating or kinetics, while others have reported beta1 mediated changes in channel gating and/or kinetics."
reach
"This raises an interesting question about the functional role of beta 1 modulation of hH1 channels."
BetA1 inhibits SCN5A.
| 1
BetA1 inhibits SCN5A. 1 / 1
| 1
reach
"Beta 1 does not affect the time constants of slow inactivation in hSkM1 sodium channels, but accelerates slow inactivation onset and recovery in hH1 sodium channels."
Wnt affects SCN5A
| 1 4
Wnt inhibits SCN5A.
| 1 2
Wnt inhibits SCN5A. 3 / 3
| 1 2
sparser
"Overexpression or knockdown of Tbx3 directly modified Na v 1.5 and I Na , whereas CRISPR/Cas9-induced mutations at TCF4 binding sites within the Scn5a promoter attenuated Wnt inhibition of Scn5a and Na v 1.5."
reach
"Overexpression or knockdown of Tbx3 directly modified Na v 1.5 and I Na, whereas CRISPR and Cas9 induced mutations at TCF4 binding sites within the Scn5a promoter attenuated Wnt inhibition of Scn5a and Na v 1.5."
reach
"Moreover, Wnt GOF down-regulates Scn5a and Cx43 in these regions of the ventricles while AVC enriched genes such as Tbx3 and periostin (seen in developing annulus fibrosus) are up-regulated."
Wnt decreases the amount of SCN5A.
| 2
Wnt decreases the amount of SCN5A. 2 / 2
| 2
reach
"Ventricular Notch activation upregulates Scn5a expression, while ectopic Wnt activation downregulates Scn5a expression, consistent with programming to an AV junction like phenotype."
reach
"Chromatin immunoprecipitation showed that Wnt signalling inhibits Scn5a expression through downstream mediator (TCF4) binding to both Tbx3 and Scn5a promoters."
TPS-sab affects SCN5A
| 5
| 3
sparser
"There have been 13 previous SCN5A mutations associated with familial SSS by itself or in combination with BrS or LQTS have thus far been identified."
sparser
"Six heterozygous SCN5A mutations have been associated with an autosomal recessive congenital SSS with complete penetrance also associated with conduction disorders including evidence for latent atrioventricular conduction system disease."
sparser
"The overlap of SSS and gain-of-function mutations associated with LQT3 is more complex."
| 1
sparser
"It appears that cardiac-specific RAS dysregulation causing changes in SCN5A and gap junction protein levels may be associated with non-familial SSS."
SCN5A binds PSMD4, TPS-sab, bop, and DCM. 1 / 1
| 1
sparser
"Since then, mutations in all domains of SCN5A have been associated with LQTS, BrS [1], PFHB [ xref ], SSS [ xref ], DCM [ xref ] and l-AF [ xref ]."
SCN5A affects PMCA4b
| 5
SCN5A binds PMCA4b.
| 4
SCN5A binds SNTA1, NOS1, and PMCA4b. 4 / 4
| 4
reach
"XREF_BIBR The other three variants (G54R, P56S, and T262P), while considered functionally insignificant in the modification of SCN5A channel biology and now classified as a functional insignificant variant, may have helped nevertheless to elucidate which functional domains of SNTA1 are most important in maintaining integrity and proper function of the SCN5A, nNOS, SNTA1, and PMCA4b complex."
reach
"In conclusion, this study implicates SNTA1 as a novel SIDS-susceptibility gene, whereby mutant SNTA1 disturbs the nNOS, SNTA1, PMCA4b, and SCN5A complex, releasing inhibition of associated nNOS by PMCA4b and resulting in increased peak and late I Na via the up-regulated endogenous NO."
reach
"For the SCN5A, SNTA1, nNOS, and PMCA4b complex it was shown that the SNTA1 mutation disrupted the nNOS suppressor PMCA4b from the complex [XREF_BIBR; XREF_BIBR]; in contrast, Cav3-F97C remains in the complex, but apparently has lost the ability to suppress nNOS."
reach
"In order to observe the effect of NOS inhibitor on the PMCA4b, nNOS, SNTA1, and SCN5A complex, L-NMMA (100 muM) was introduced into the HEK293 cell culture medium 12 hours prior to testing."
SCN5A activates PMCA4b.
| 1
SCN5A activates PMCA4b. 1 / 1
| 1
reach
"Based on these data, we speculate that the three mutations may disturb the interaction of PMCA4b and SNTA1 in the whole macromolecular complex SCN5A, nNOS, SNTA1, and PMCA4b, thus relieving the negative regulation of PMCA4b on nNOS, and thereby resulting in an increase of local NO concentrations and a biophysical modification of the sodium channel."
SCN5A affects PGR
| 4 1
SCN5A binds PGR.
| 4
SCN5A binds MYH6 and PGR. 2 / 2
| 2
sparser
"Rare variations in MYH6 and SCN5A are associated with PR interval."
sparser
"Variation in two gene regions, MYH6 ( P = 5.9×10 −11 ) and SCN5A ( P = 1.1×10 −7 ), was associated with PR interval ( xref ). xref show the association of each rare variant within MYH6 and SCN5A with PR interval, respectively."
| 1
sparser
"Examining transcripts from human atria (n=369 samples), ventricle (n=313 samples) and other tissues, we found no evidence that SCN5A transcript expression is associated with the PR and QRS index SNPs identified in the current study (rs10428132 or rs6599251), nor with the most significant SCN10A SNPs from prior studies of PR or QRS, including rs6801957 ( xref , xref , and xref ). xref , xref While we found expression of Nav1.8 channel protein in freshly obtained human atrial tissues using immunohistochemistry ( xref ), expression of SCN10A transcript was low in atrial and ventricular tissue, therefore hampering our ability to identify a SNP SCN10A eQTL association."
SCN5A binds TBX5 and PGR. 1 / 1
| 1
sparser
"In meta-analyses of P-wave duration, we identified 6 significant ( P <5×10 - 8 ) novel loci and replicated a prior association with S CN10A. We identified 3 loci at SCN5A , TBX5 , and CAV1/CAV2 that were jointly associated with the PR interval, PR segment, and P-wave duration."
SCN5A activates PGR.
| 1
SCN5A activates PGR. 1 / 1
| 1
reach
"The intact anesthetized Scn5a +/- mice showed features of second-degree AV block and increased PR intervals, consistent with the longer conduction latencies previously observed in Langendorff perfused Scn5a +/- hearts."
| 1 2 2
| 2 2
reach
"The fact that neither pharmacologic nor genetic knockdown of SCN5A inhibited cell invasion completely may be explained by the presence of other mechanisms that contribute to cell invasion, existence of additional functional isoforms (such as Na v 1.8, encoded by SCN10A, the most TTX resistant isoform; see XREF_SUPPLEMENTARY), or simply incomplete gene knockdown."
eidos
"Knockdown of Nav1.5 inhibits cell proliferation , migration and invasion via Wnt / beta-catenin signaling pathway in oral squamous cell carcinoma ."
eidos
"Knockdown of Nav1.5 inhibits cell proliferation , migration and invasion via Wnt / beta-catenin signaling pathway in oral squamous cell carcinoma ."
reach
"Taken together, our inhibitor and knockdown experiments suggest that veratridine stimulated invasion by SW620 colon cancer cells is mediated by an SCN5A dependent pathway involving PKA/RAP1B/MEK/ERK (predominant pathway)."
sparser
"The fact that neither pharmacologic nor genetic knockdown of SCN5A inhibited cell invasion completely may be explained by the presence of other mechanisms that contribute to cell invasion, existence of additional functional isoforms (such as Na v 1.8, encoded by SCN10A , the most TTX-resistant isoform; see xref ), or simply incomplete gene knockdown."
SCN5A affects NFkappaB
| 3 2
SCN5A binds NFkappaB.
| 3 1
| 3 1
sparser
"Elevated angiotensin II levels and the increased oxidative stress increase NF-κB binding to the SCN5A promoter region, thereby decreasing its transcriptional activity (Shang et al., xref )."
reach
"Angiotensin II (AngII) or H 2 O 2 treatment of cardiomyocytes results in increased NF-kappaB binding to SCN5A promoter with subsequent reduction in transcriptional activity [XREF_BIBR]."
sparser
"Angiotensin II (AngII) or H 2 O 2 treatment of cardiomyocytes results in increased NF-κB binding to SCN5A promoter with subsequent reduction in transcriptional activity [ xref ]."
sparser
"This is in agreement with another study xref that demonstrated that NFκB can directly bind to the SCN5A promoter, which is involved in down-transcription of the Na v 1.5 channel in rat ventricular cells."
SCN5A activates NFkappaB.
| 1
Mutated SCN5A activates NFkappaB. 1 / 1
| 1
reach
"Mutation of the scn5a promoter NF-kappaB binding site prevented decreased activity in response to ANG II and H (2) O (2)."
SCN5A affects LMNA
| 5
| 2
sparser
"Moreover, they have significantly downregulated Na v 1.5 channel expression and increased binding of Lamin A/C to the promoter of SCN5A, the channel's gene."
sparser
"These characteristics are considered as “red flags” for LMNA and SCN5A associated disease [ xref ]."
| 2
sparser
"In this study we focused solely on the relevant 19 PCCD genes including SCN5A , SCN1B , TRPM4 , GJA5 and LMNA that have already been associated with isolated cardiac conduction defects together with GJA1 , GJC1 , SCN10A , NKX2-5 , TBX5 , SNTA1 , PRKAG2 , RYR2 , EMD , BMP2 , BMPR1A , GATA4 , MSX2 and TNNI3K as likely candidate genes."
sparser
"Nineteen genes known or suspected to be involved in conduction defects were sequenced in these patients using the HaloPlex™ System, resulting in a mean coverage depth of 578 × per sample: SCN5A , SCN1B , TRPM4 , GJA5 and LMNA that have already been associated with isolated cardiac conduction defects together with GJA1 , GJC1 , SCN10A , NKX2-5 , TBX5 , SNTA1 , PRKAG2 , RYR2 , EMD , BMP2 , BMPR1A , GATA4 , MSX2 and TNNI3K . A graphical representation of the mean coverage obtained for the 5 major genes is provided in Supplemental Fig. 1 ."
SCN5A binds LMNA and DCM. 1 / 1
| 1
sparser
"For example, mutations in LMNA and SCN5A have been associated with a cardiac syndrome of DCM, impaired automaticity and conduction, and atrial fibrillation ( xref – xref )."
SCN5A affects ELAVL1
| 5
| 5
sparser
"These data suggest that HuR specifically associates with SCN5A mRNA."
sparser
"HuR associated with SCN5A mRNA."
sparser
"The association of SCN5A mRNA with HuR was examined by PCR analyses following reverse transcription of RNA isolated from the IP precipitates using the procedure described before. xref SCN5A PCR products were highly enriched in samples precipitated with anti-HuR antibody, while no SCN5A PCR product was detected in control IgG pellets."
sparser
"The association of HuR and SCN5A mRNA protected SCN5A mRNA from decay."
sparser
"HuR was associated with SCN5A mRNA in cardiomyocytes, and the expression of HuR was downregulated in failing hearts."
LMNA affects SCN5A
| 5
| 2
sparser
"Moreover, they have significantly downregulated Na v 1.5 channel expression and increased binding of Lamin A/C to the promoter of SCN5A, the channel's gene."
sparser
"These characteristics are considered as “red flags” for LMNA and SCN5A associated disease [ xref ]."
| 2
sparser
"In this study we focused solely on the relevant 19 PCCD genes including SCN5A , SCN1B , TRPM4 , GJA5 and LMNA that have already been associated with isolated cardiac conduction defects together with GJA1 , GJC1 , SCN10A , NKX2-5 , TBX5 , SNTA1 , PRKAG2 , RYR2 , EMD , BMP2 , BMPR1A , GATA4 , MSX2 and TNNI3K as likely candidate genes."
sparser
"Nineteen genes known or suspected to be involved in conduction defects were sequenced in these patients using the HaloPlex™ System, resulting in a mean coverage depth of 578 × per sample: SCN5A , SCN1B , TRPM4 , GJA5 and LMNA that have already been associated with isolated cardiac conduction defects together with GJA1 , GJC1 , SCN10A , NKX2-5 , TBX5 , SNTA1 , PRKAG2 , RYR2 , EMD , BMP2 , BMPR1A , GATA4 , MSX2 and TNNI3K . A graphical representation of the mean coverage obtained for the 5 major genes is provided in Supplemental Fig. 1 ."
SCN5A binds LMNA and DCM. 1 / 1
| 1
sparser
"For example, mutations in LMNA and SCN5A have been associated with a cardiac syndrome of DCM, impaired automaticity and conduction, and atrial fibrillation ( xref – xref )."
Sodium atom affects SCN5A
| 1 3
Sodium atom inhibits SCN5A.
| 2
| 1
reach
"When maximal conductance of fast I Na was reduced to 35% of WT model to simulate the SCN5A defect, phase 0 overshoot decreased from +11.4 mV to -8.7 mV, conduction velocity slowed from 61 to 40 cm/sec (66% of WT) and the dome of the right ventricular epicardial action potential was lost (XREF_FIG), consistent with the cellular changes associated with the development of Brugada syndrome."
Sodium atom inhibits mutated SCN5A. 1 / 1
| 1
reach
"Because the double mutant channel showed a negative shift of the steady-state inactivation curve and an increased proportion of Na channels entering an intermediate state of inactivation, cardiac Na current is reduced, which is characteristic of SCN5A mutations in patients with symptomatic Brugada syndrome."
| 1
sparser
"Mutations in the genes KCNQ1 , KCNH2 , KCNE1 and KCNE2 encoding cardiac K + channel subunits and the SCN5A gene encoding a Na + channel subunit are associated with long QT syndrome (LQTS), a life-threatening arrhythmogenic disorder characterized by prolongation of the QT interval on electrocardiograms [2] ."
Sodium atom activates SCN5A.
| 1
| 1
reach
"Na V 1.5 expression was suppressed by H 2 O 2 activating NF-KappaB and partially inhibiting SCN5a promoter activity XREF_BIBR."
Gag affects SCN5A
| 4
Gag activates SCN5A. 4 / 4
| 4
reach
"Similar results were obtained with a deletion mutant consisting of the beta 2 ED plus the beta 1 MA (beta 21Delta, XREF_FIG, XREF_TABLE), confirming that the beta 1 MA is not sufficient to modulate hH1 currents."
reach
"In contrast, beta 1 -like effects on hH1 currents were observed when coexpressing the opposite chimera beta 211, indicating that the MA plus the ID of the beta 1 subunit are required to modulate hH1 channels (XREF_FIG, XREF_TABLE)."
reach
"This result shows that the beta 1 MA is required in beta 11Delta to modulate hH1 channels."
reach
"In conclusion, the cardiac Na + channel isoform hH1 is modulated by the beta 1 MA plus the ID, whereas the beta 1 ED was sufficient to modulate the neuronal isoform IIA."
VCL-D841H affects SCN5A
| 4
VCL-D841H activates SCN5A.
| 3
VCL-D841H activates SCN5A. 3 / 3
| 3
reach
"The aggravation of loss of function of SCN5A caused by VCL-D841H under acidosis supports that nocturnal sleep respiratory disorders with acidosis may play a key role in the pathogenesis of SUNDS."
reach
"The significant aggravation of loss of function of SCN5A caused by VCL-D841H under acidosis further supports the idea that nocturnal sleep respiratory disorders with acidosis may play a crucial role in triggering the deadly arrhythmia underlying SUNDS victims."
reach
"All these results suggest that VCL-D841H may be an independent risk factor for Chinese SUNDS through the interaction between VCL and SCN5A by which VCL-D841H causes SCN5A either loss or gain of function in the setting of environmental and/or genetic factors."
VCL-D841H inhibits SCN5A.
| 1
VCL-D841H inhibits SCN5A. 1 / 1
| 1
reach
"VCL was also confirmed to directly interact with SCN5A, and VCL-D841H did not disrupt the association of VCL and SCN5A."
TBX5 affects SCN5A
| 2 2
TBX5 increases the amount of SCN5A.
| 2
TBX5 increases the amount of SCN5A. 2 / 2
| 2
reach
"In particular, the T-box transcription factor TBX3 suppresses, whereas the related factor TBX5 enhances transcription of SCN5A and SCN10A in mouse heart by interacting with conserved binding sites located within these two neighboring genes."
reach
"TBX5, which plays a fundamental role during cardiac development, stimulates SCN5A expression in the adult cardiac conduction system by binding gene enhancer elements (Arnolds et al., 2012; Van Den Boogaard et al., 2012)."
TBX5 binds SCN5A.
| 1
SCN5A binds TBX5 and PGR. 1 / 1
| 1
sparser
"In meta-analyses of P-wave duration, we identified 6 significant ( P <5×10 - 8 ) novel loci and replicated a prior association with S CN10A. We identified 3 loci at SCN5A , TBX5 , and CAV1/CAV2 that were jointly associated with the PR interval, PR segment, and P-wave duration."
TBX5 activates SCN5A.
| 1
TBX5 activates SCN5A. 1 / 1
| 1
sparser
"Similar to the other atrial working myocardial genes such as Nppa and Cx40, Scn5a is directly activated by Nkx2–5 and Tbx5, but repressed by Tbx3 [ xref , xref , xref ]."
| 2 2
sparser
"11 In addition, the ethnic-specific common cardiac sodium channel polymorphism S1103Y-SCN5A has been associated with African American SIDS and sudden cardiac death in young black adults."
sparser
"In addition, the ethnic-specific common cardiac sodium channel polymorphism S1103Y-SCN5A has been associated with African American SIDS and sudden cardiac death in young black adults [ xref , xref , xref ], reinforcing the hypothesis that genetic issues may be strikingly involved in SIDS."
Sudden Infant Death phosphorylates SCN5A.
| 1
Sudden Infant Death leads to the phosphorylation of SCN5A on S1503. 1 / 1
| 1
reach
"Using a heterologous expression system, we show that GPD1L associated with SCN5A and that the BrS- and SIDS related mutations in GPD1L caused a loss of enzymatic function resulting in glycerol-3-phosphate PKC dependent phosphorylation of SCN5A at serine 1503 (S1503) through a GPD1L dependent pathway."
Sudden Infant Death dephosphorylates SCN5A.
| 1
Sudden Infant Death leads to the dephosphorylation of SCN5A on S1503. 1 / 1
| 1
reach
"Using a heterologous expression system, we show that GPD1L associated with SCN5A and that the BrS- and SIDS related mutations in GPD1L caused a loss of enzymatic function resulting in glycerol-3-phosphate PKC dependent phosphorylation of SCN5A at serine 1503 (S1503) through a GPD1L dependent pathway."
SCN5A affects ion channel
| 3 1
| 3
| 1
sparser
"Thus, the association of nNOS complex-related proteins with both SCN5A and other cardiac ion channels deserves further study."
sparser
"The XIRP proteins interact with cardiac ion channel proteins Nav1.5 and Kv1.5 within intercalated 8 ."
| DOI
sparser
"The rs2200733 has been associated with expression of PITX2 , which is a transcription factor, and the expression level of PITX2 has been associated with structural changes as well as expression of ion channel genes such as SCN5A [ xref ]."
SCN5A increases the amount of ion channel.
| 1
SCN5A increases the amount of ion channel. 1 / 1
| 1
reach
"We also investigated the US response of Na V 1.5 (SCN5A), a Na + -selective voltage activated ion channel expressed in cardiomyocytes, neurons, and other excitable cells XREF_BIBR XREF_BIBR XREF_BIBR XREF_BIBR, and also showing mechanosensitive responses XREF_BIBR XREF_BIBR XREF_BIBR XREF_BIBR."
SCN5A affects Lqh III
| 4
| 4
reach
"Strong Interaction between hH1 and Lqh III."
reach
"Compared with the results obtained for the other two toxins and also for the toxin interaction with muI sodium channels (Chen et al. 2000), the interaction between hH1 and Lqh III shows unusual properties."
reach
"However, the dissociation rate of Lqh III from hH1 channels was much slower than that from muI channels (at +100 mV, tau off = 2,010 vs. 322 ms), suggesting that Lqh III binds to hH1 channels most strongly and the interaction between the hH1 channel and Lqh III is unusual."
reach
"With this study, we intended to evaluate the effect of Lqh III on slow inactivation of hH1 channels, as we found that Lqh III binds to hH1 channels so tightly such that strong depolarizations, which are needed to induce slow inactivation, can not completely dissociate Lqh III from these channels."
SCN5A affects LQT-3
| 4
SCN5A activates LQT-3. 2 / 2
| 2
reach
"2,3 Unlike LQT-1 and LQT-2, both loss-of-function potassium channelopathies, LQT-3 is caused by gain-of-function mutations in SCN5A, the cardiac sodium-channel gene."
reach
"Among the numerous different genetic subtypes (all encoding a protein that is directly or indirectly involved in repolarization) of the syndrome, LQT-3 is caused by gain-of-function mutations in SCN5A."
Mutated SCN5A activates LQT-3. 2 / 2
| 2
reach
"Other less common mechanisms of SCN5A mutations to cause LQT-3 include increased window current [XREF_BIBR, XREF_BIBR], slower inactivation [XREF_BIBR, XREF_BIBR], faster recovery from inactivation [XREF_BIBR, XREF_BIBR], and larger peak I Na density [XREF_BIBR]."
reach
"More surprisingly, some SCN5A mutations cause symptoms of both LQT-3 (I Na gain-of-function) and BrS (I Na loss-of-function) in members of one family, or LQT-3 in one family and BrS in another [XREF_BIBR, XREF_BIBR, XREF_BIBR]."
SCN5A affects LQT
| 4
SCN5A activates LQT.
| 3
SCN5A activates LQT. 2 / 2
| 2
reach
"Mutations in KVLQT1, HERG, SCN5A, and KCNE1, genes encoding cardiac ion channels, cause LQT."
reach
"In summary, we have identified a gene, SCN5A, that is likely to cause LQT."
Mutated SCN5A activates LQT. 1 / 1
| 1
reach
"These data suggest that SCN5A mutations cause LQT."
SCN5A inhibits LQT.
| 1
Mutated SCN5A inhibits LQT. 1 / 1
| 1
reach
"It is un- likely that more deleterious mutations of SCN5A would cause LQT."
SCN5A affects GPD1L
| 2 2
SCN5A binds GPD1L.
| 2 1
| 2 1
sparser
"They demonstrated association of GPD1L with SCN5A; mutants of GPD1L increased PKC-mediated phosphorylation of SCN5A which in turn causes a dysfunction in sodium current, a mechanism for ventricular arrhythmias."
sparser
"Using a heterologous expression system, we show that GPD1L associated with SCN5A and that the BrS- and SIDS-related mutations in GPD1L caused a loss of enzymatic function resulting in glycerol-3-phosphate PKC-dependent phosphorylation of SCN5A at serine 1503 (S1503) through a GPD1L-dependent pathway."
reach
"Using a heterologous expression system, we show that GPD1L associated with SCN5A and that the BrS- and SIDS related mutations in GPD1L caused a loss of enzymatic function resulting in glycerol-3-phosphate PKC dependent phosphorylation of SCN5A at serine 1503 (S1503) through a GPD1L dependent pathway."
SCN5A activates GPD1L.
| 1
SCN5A activates GPD1L. 1 / 1
| 1
reach
"[XREF_BIBR - XREF_BIBR] Similar scenarios could also be seen in cases of acquired long QT syndrome and ischemic cardiomyopathy, in which rare variants (KCNH2, KCNE1, KCNE2, KCNQ2, SCN5A, and RyR2 in drug induced long QT syndrome and CASQ2, RAB3GAP1, ZNF365, CXADR, GPC5, GPD1L, NOS1AP, and SCN5A in ischemic cardiomyopathy) were associated with higher risk of malignant arrhythmia and SCD."
SCN5A affects FGF12
1 | 1 2
SCN5A inhibits FGF12.
| 2
SCN5A inhibits FGF12. 2 / 2
| 2
reach
"A previous study14 reported that a variation in SCN5A (p.H1849R) could block the regulation of FGF12 and cause human arrhythmia."
reach
"The p.Q7R mutation reduced binding to the Na V 1.5 C-terminus and Na + channel current density, leading to Na + channel loss-of-function phenotype consistent with that in BrS.12, 13 Furthermore, Musa etal reported that a variation in SCN5A (p.H1849R) blocks the regulation of FGF12 and causes human arrhythmia.14 This evidence highlighted that the variations in FGF12 may affect the interaction between FGF12 and Na + channel, leading to arrhythmia."
SCN5A binds FGF12.
1 | 1
1 | 1
sparser
"We showed that a loss-of-function mutation in FGF12 that eliminates Na + channel modulation is associated with Brugada syndrome, an inherited cardiac arrhythmia[ xref ], and a mutation in the cardiac Na + channel gene SCN5A that affects FGF12 interaction and Na V 1.5 channel function in ventricular myocytes leads to a life-threatening arrhythmia syndrome[ xref ]."
signor
"Sodium channel fast inactivation is modulated by alpha subunit interaction with a family of cytoplasmic proteins termed fibroblast growth factor homologous factors (FHFs). In this paper, we report that all A-type FHFs exert rapid onset long-term inactivation on Nav1.6 and other sodium channels."
SCN5A affects CRYAB
4 |
4 |
biogrid
No evidence text available
biogrid
No evidence text available
biogrid
No evidence text available
biogrid
No evidence text available
SCN5A affects CCD
| 4
SCN5A activates CCD. 3 / 3
| 3
reach
"Notably, dozens of other severe loss-of-function mutations in SCN5A are known to cause BrS, CCD, or both XREF_BIBR."
reach
"Taking together, the identified SCN5A p. 1493delK mutation leads to CCD, ventricular arrhythmias and SCD, in the absence of signs of BrS or LQTS."
reach
"Mutations in SCN5A, encoding the alpha-subunit of the human cardiac sodium channel (hNa v 1.5), have been reported to cause overlapping syndromes including Brugada syndrome (BrS) XREF_BIBR, LQT3 form of the long-QT syndrome XREF_BIBR, cardiac conduction disease (CCD, also referred to as Lev-Lenegre disease) XREF_BIBR, congenital sick sinus syndrome (SSS) XREF_BIBR, and/or atrial fibrillation XREF_BIBR, that can manifest individually or together."
Mutated SCN5A activates CCD. 1 / 1
| 1
reach
"SCN5A mutations are known to cause CCD, BrS or LQTS, in some cases producing an overlap syndrome exhibiting mixed phenotypes."
SCN5A affects CALM1
4 |
4 |
biogrid
No evidence text available
biogrid
No evidence text available
biogrid
No evidence text available
biogrid
No evidence text available
PGR affects SCN5A
| 4
SCN5A binds MYH6 and PGR. 2 / 2
| 2
sparser
"Rare variations in MYH6 and SCN5A are associated with PR interval."
sparser
"Variation in two gene regions, MYH6 ( P = 5.9×10 −11 ) and SCN5A ( P = 1.1×10 −7 ), was associated with PR interval ( xref ). xref show the association of each rare variant within MYH6 and SCN5A with PR interval, respectively."
| 1
sparser
"Examining transcripts from human atria (n=369 samples), ventricle (n=313 samples) and other tissues, we found no evidence that SCN5A transcript expression is associated with the PR and QRS index SNPs identified in the current study (rs10428132 or rs6599251), nor with the most significant SCN10A SNPs from prior studies of PR or QRS, including rs6801957 ( xref , xref , and xref ). xref , xref While we found expression of Nav1.8 channel protein in freshly obtained human atrial tissues using immunohistochemistry ( xref ), expression of SCN10A transcript was low in atrial and ventricular tissue, therefore hampering our ability to identify a SNP SCN10A eQTL association."
SCN5A binds TBX5 and PGR. 1 / 1
| 1
sparser
"In meta-analyses of P-wave duration, we identified 6 significant ( P <5×10 - 8 ) novel loci and replicated a prior association with S CN10A. We identified 3 loci at SCN5A , TBX5 , and CAV1/CAV2 that were jointly associated with the PR interval, PR segment, and P-wave duration."
NOS1 affects PMCA4b, SCN5A, and SNTA1
| 4
SCN5A binds SNTA1, NOS1, and PMCA4b. 4 / 4
| 4
reach
"XREF_BIBR The other three variants (G54R, P56S, and T262P), while considered functionally insignificant in the modification of SCN5A channel biology and now classified as a functional insignificant variant, may have helped nevertheless to elucidate which functional domains of SNTA1 are most important in maintaining integrity and proper function of the SCN5A, nNOS, SNTA1, and PMCA4b complex."
reach
"In conclusion, this study implicates SNTA1 as a novel SIDS-susceptibility gene, whereby mutant SNTA1 disturbs the nNOS, SNTA1, PMCA4b, and SCN5A complex, releasing inhibition of associated nNOS by PMCA4b and resulting in increased peak and late I Na via the up-regulated endogenous NO."
reach
"For the SCN5A, SNTA1, nNOS, and PMCA4b complex it was shown that the SNTA1 mutation disrupted the nNOS suppressor PMCA4b from the complex [XREF_BIBR; XREF_BIBR]; in contrast, Cav3-F97C remains in the complex, but apparently has lost the ability to suppress nNOS."
reach
"In order to observe the effect of NOS inhibitor on the PMCA4b, nNOS, SNTA1, and SCN5A complex, L-NMMA (100 muM) was introduced into the HEK293 cell culture medium 12 hours prior to testing."
NEDD4L affects SCN5A
2 2 |
NEDD4L binds SCN5A.
2 |
2 |
hprd
No evidence text available
hprd
No evidence text available
NEDD4L ubiquitinates SCN5A.
1 |
NEDD4L ubiquitinates SCN5A. 1 / 1
1 |
signor
"The control of Nav density at the cell membrane is crucial to ensuring normal neuronal excitability. Navs are subject to posttranslational modifications that may influence their cell membrane availability. Ubiquitylation is a key process that orchestrates the internalization and subsequent degradation or recycling of Navs. This is accomplished by ubiquitin protein ligases, such as NEDD4-2 (neuronal precursor cell expressed developmentally downregulated-4 type 2)."
NEDD4L decreases the amount of SCN5A.
1 |
NEDD4L decreases the amount of SCN5A. 1 / 1
1 |
signor
"The control of Nav density at the cell membrane is crucial to ensuring normal neuronal excitability. Navs are subject to posttranslational modifications that may influence their cell membrane availability. Ubiquitylation is a key process that orchestrates the internalization and subsequent degradation or recycling of Navs. This is accomplished by ubiquitin protein ligases, such as NEDD4-2 (neuronal precursor cell expressed developmentally downregulated-4 type 2)."
FYN affects SCN5A
2 2 |
FYN phosphorylates SCN5A.
2 1 |
FYN phosphorylates SCN5A on Y1495. 2 / 2
1 1 |
biopax:phosphositeplus
No evidence text available
signor
"This study addresses the effects of the src family tyrosine kinase fyn on na(v)1.5 cardiac sodium channels. Sodium currents were acquired by whole cell recording on hek-293 cells transiently expressing na(v)1.5. Acute treatment of cells with insulin caused a depolarizing shift in steady-state inactivation, an effect eliminated by the src-specific tyrosine kinase inhibitor pp2 we provide evidence that this linker is a substrate for fyn in vitro, and that y1495 is a preferred phosphorylation site."
FYN phosphorylates SCN5A on Y1494. 1 / 1
1 |
biopax:phosphositeplus
No evidence text available
FYN inhibits SCN5A.
1 |
FYN inhibits SCN5A. 1 / 1
1 |
signor
"This study addresses the effects of the src family tyrosine kinase fyn on na(v)1.5 cardiac sodium channels. Sodium currents were acquired by whole cell recording on hek-293 cells transiently expressing na(v)1.5. Acute treatment of cells with insulin caused a depolarizing shift in steady-state inactivation, an effect eliminated by the src-specific tyrosine kinase inhibitor pp2 we provide evidence that this linker is a substrate for fyn in vitro, and that y1495 is a preferred phosphorylation site."
CRYAB affects SCN5A
4 |
4 |
biogrid
No evidence text available
biogrid
No evidence text available
biogrid
No evidence text available
biogrid
No evidence text available
| 4
CAMK2_complex phosphorylates SCN5A. 4 / 4
| 4
rlimsp
"Specifically, CaMKII phosphorylation of NaV1.5 shifts the voltage dependence of inactivation to negative potentials without affecting channel activation, slows recovery from and enhances entry into slower forms of inactivation, and increases INaL (Wagner et al., 2006)."
rlimsp
"In the present study, we used label-free mass spectrometry to assess phosphorylation of human Na(V)1.5 purified from HEK293 cells with full coverage of phosphorylatable sites and identified 23 sites that were phosphorylated by CaMKII in vitro."
rlimsp
"CaMKII Phosphorylation of Na(V)1.5: Novel in Vitro Sites Identified by Mass Spectrometry and Reduced S516 Phosphorylation in Human Heart Failure."
rlimsp
"This work furthers our understanding of the phosphorylation of Na(V)1.5 by CaMKII under normal and disease conditions, provides novel CaMKII target sites for functional validation, and provides the first phospho-proteomic map of full-length human Na(V)1.5."
CALM1 affects SCN5A
4 |
4 |
biogrid
No evidence text available
biogrid
No evidence text available
biogrid
No evidence text available
biogrid
No evidence text available
| 3
Salicylic acid inhibits SCN5A.
| 2
reach
"Salicylate enhanced the quinidine induced tonic and use dependent block of both hH1 and hSkM1 currents at a holding potential (HP) of -100 mV but not at -140 mV."
reach
"Salicylate decreased the IC50 value for the quinidine induced tonic block of hH1 at an HP of -100 mV, and produced a negative shift in the steady-state inactivation curve of hH1 in the presence of quinidine."
Salicylic acid activates SCN5A.
| 1
reach
"Salicylate decreased the IC50 value for the quinidine induced tonic block of hH1 at an HP of -100 mV, and produced a negative shift in the steady-state inactivation curve of hH1 in the presence of quinidine."
Moricizine affects SCN5A
| 3
Moricizine inhibits SCN5A.
| 2
| 2
reach
"Moricizine at 3 muM reduced hH1 current to 50% of control."
reach
"As shown by the peak hH1 I - V curves, moricizine blocked hH1 without changes in either the threshold potential (-60 mV), the maximum peak hH1 current potential (-40 mV), or the reversal potential (+60 mV)."
Moricizine activates SCN5A.
| 1
| 1
reach
"Washout of the moricizine partially restored the amplitude of hH1 over the range of membrane potentials."
Celecoxib affects SCN5A
| 3
| 3
reach
"Celecoxib inhibited the hERG, SCN5A, KCNQ1 and KCNQ1 and MinK channels expressed in HEK-293 cells with IC 50 s of 6.0 microM, 7.5 microM, 3.5 microM and 3.7 microM respectively, and the KCND3 and KChiP2 channels expressed in CHO cells with an IC 50 of 10.6 microM."
reach
"In addition, we explored if celecoxib inhibited human SCN5A channels, examined concentration dependence of inhibition of human KCNQ1, KCNQ1 and MinK and KCND3 and KChiP2 channels XREF_BIBR, and studied the nature of inhibition of human KCNQ1 and MinK channels."
reach
"In the present study we examined if celecoxib could inhibit human SCN5A."
TBX3 affects SCN5A
| 2 1
TBX3 binds SCN5A.
| 2
| 1
sparser
"Chromatin immunoprecipitation showed that Wnt signalling inhibits Scn5a expression through downstream mediator (TCF4) binding to both Tbx3 and Scn5a promoters."
SCN5A binds TBX3 and TCF4. 1 / 1
| 1
sparser
"Strategies to block TCF4 binding to the Tbx3 and Scn5a promoters would represent novel strategies for cardiac-specific inhibition of the Wnt pathway to rescue I Na and prevent sudden cardiac deaths."
TBX3 inhibits SCN5A.
| 1
TBX3 inhibits SCN5A. 1 / 1
| 1
reach
"Overexpression or knockdown of Tbx3 directly modified Na v 1.5 and I Na, whereas CRISPR and Cas9 induced mutations at TCF4 binding sites within the Scn5a promoter attenuated Wnt inhibition of Scn5a and Na v 1.5."
| 2 1
eidos
"Knockdown of Nav1.5 inhibits cell proliferation , migration and invasion via Wnt / beta-catenin signaling pathway in oral squamous cell carcinoma ."
eidos
"Knockdown of Nav1.5 inhibits cell proliferation , migration and invasion via Wnt / beta-catenin signaling pathway in oral squamous cell carcinoma ."
reach
"Immuno-electronmicrographs showed that transfection of hH1-GFP and hH1 induced proliferation of three types of endoplasmic reticulum (ER) membranes to accommodate the heterologously expressed proteins."
SCN5A affects calcium(2+)
| 3
SCN5A inhibits calcium(2+).
| 1
| 1
reach
"The pacing-control group exhibited shortened AERP, decreased CV, increased AF inducibility and tissue fibrosis, and down-regulated L-type Ca (2+) channel (LCC), SCN5A, Kv4.3 and connexin43 (Cx43)."
| 1
reach
"proposed a novel mechanism for modulation of Na channel function where Ca ions bind directly to hH1 via an EF-hand motif in the C-terminal domain."
SCN5A activates calcium(2+).
| 1
| 1
reach
"The observed interacting effects of Scn5a +/DeltaKPQ genotype and age are consistent with increased incidences of alternans in old Scn5a +/DeltaKPQ mice producing an underlying Ca 2+ cycling alternans given age related reductions in myocardial SR Ca 2+ ATPase (SERCA) density 69."
SCN5A affects SCD
| 1 2
SCN5A binds SCD.
| 1 1
| 1 1
sparser
"Of the 27 candidate SNPs, one SNP (rs11720524) located in intron 1 of SCN5A which was previously associated with SCD was significantly associated with VF caused by first STEMI."
reach
"Of the 27 candidate SNPs, one SNP (rs11720524) located in intron 1 of SCN5A which was previously associated with SCD was significantly associated with VF caused by first STEMI."
SCN5A activates SCD.
| 1
SCN5A activates SCD. 1 / 1
| 1
reach
"Taking together, the identified SCN5A p. 1493delK mutation leads to CCD, ventricular arrhythmias and SCD, in the absence of signs of BrS or LQTS."
SCN5A affects INA
| 1 2
SCN5A inhibits INA.
| 2
SCN5A inhibits INA. 1 / 1
| 1
reach
"Co-expression of SCN5A-E1784K and SCN5A-WT reduced INa, P to 70.03% of WT, shifted steady-state inactivation by -11.03 mV, and increased INa, L from 0.14% to 1.86% of INa, P. Similar changes were observed when SCN5A-E1784K was co-expressed with SCN5A-H558R."
Mutated SCN5A inhibits INA. 1 / 1
| 1
reach
"The SCN5A mutation reduced peak INa to 39% of WT (p < 0.01), shifted steady-state inactivation by -18.0 mV (p < 0.01) and increased late I (Na) from 0.14% to 2.01% of peak I (Na) (p < 0.01)."
SCN5A binds INA.
| 1
| 1
sparser
"Compared with Cav3-WT, Cav3-F97C produced significantly larger peak INa amplitudes, and showed 3.3-fold increase in the late INa associated with increased S-nitrosylation of SCN5A. L-NMMA reversed both the Cav3-F97C induced increase in late and peak INa and decreased S-nitrosylation of SCN5A. Overexpression of Cav3-F97C in adult rat cardiomyocytes caused a significant increase in late INa compared to Cav3-WT, and prolonged the action potential duration (APD90) in a nNOS-dependent manner."
SCN5A affects HDL
| 3
HDL binds SCN5A and HB1. 2 / 2
| 2
sparser
"DMPC associated specifically with HB1 and HB2, two HDL binding proteins recently identified in rat liver plasma membranes."
sparser
"These results support the findings of a previous study showing that HDL binding activity of both HB1 and HB2, which was determined by ligand blotting using HDL3 as a ligand, were reduced after administering cholesterol lowering agents. (Arteriosclerosis, 10: 1045-1050,1990)."
| 1
sparser
"If the interaction between HDL and HB2 reduces the adhesion-induced inflammatory cellular events that characterize arterial wall injury, thereby achieving the protection associated with higher plasma levels of HDL, these findings may provide a clue to one mitigating effect of HDL in heart disease."
SCN5A affects CALM
| 2 1
| 2 1
sparser
"24 CAV3 plays a role in prolonging action potential by binding to calmodulin, which binds SCN5A and increases its slow-inactivation kinetics in response to regional increase in the concentration of calcium."
sparser
"The IQ/AA mutation eliminated CaM binding to the carboxyl terminus of both micro1 and hH1 channels."
reach
"24 CAV3 plays a role in prolonging action potential by binding to calmodulin, which binds SCN5A and increases its slow inactivation kinetics in response to regional increase in the concentration of calcium."
SCN5A affects BS
| 3
SCN5A binds BS. 3 / 3
| 3
sparser
"Mutation R1193Q has been associated with both LQT3 and BS in the French Canadian population ( Huang et al., 2006 )."
sparser
"To date, 119 SCN5A mutations have been associated with BS ( Fig. 2 )."
sparser
"Mutations in SCN5A associated with the BS phenotype usually result in a loss of channel function by a reduction in Na+ currents."
SCN5A affects ATXN3
| 3
| 3
sparser
"Brugada syndrome is a life-threatening, inherited arrhythmia disorder associated with autosomal dominant mutations in SCN5A [ xref - xref ], the gene encoding the human cardiac Na + channel α subunit (Nav1.5) [ xref ], which contains four homologous domains, each composed of six membrane-spanning segments, linked by cytoplasmic linkers."
sparser
"Brugada syndrome is a life-threatening, inherited arrhythmia disorder associated with autosomal dominant mutations in SCN5A, the gene encoding the human cardiac Na + channel α subunit (Nav1.5)."
sparser
"Brugada syndrome (BrS) is a life-threatening, inherited arrhythmogenic syndrome associated with autosomal dominant mutations in SCN5A , the gene encoding the cardiac Na + channel alpha subunit (Na v 1.5)."
SCN5A affects AGT
| 3
SCN5A increases the amount of AGT. 3 / 3
| 3
reach
"For example, AngII inhibits delayed rectifier potassium currents in cardiac muscle, and decreases cardiac sodium channel SCN5A transcription and current."
reach
"In conclusion, ANG II can decrease scn5a transcription and current."
reach
"11 Ang II can also decrease SCN5A transcription and current through production of H 2 O 2 resulting in nuclear factor kappa B (NF-kappaB) binding to the sodium channel promoter."
| 3
reach
"Six gene variants were found including a novel missense mutation of base C to T, named Arg965 Cys (R965C), which located in 965 codon of the 17 exon in SCN5A, and five SCN5A polymorphisms including A29A (c. 87A> G), R1193Q (c. 3578G> A), D1819D (c. 5457T> C), exon11 -24 G> A, exon23 +4 A> G. SCN5A mutation is related to fever induced Brugada ECG pattern."
reach
"Genetic studies sometimes reveal a SCN5A mutation in patients with Brugada syndrome or patients with drug induced Brugada ECG."
reach
"A nonsense SCN5A mutation associated with Brugada type ECG and intraventricular conduction defects."
RANGRF affects SCN5A
| 1 2
RANGRF increases the amount of SCN5A.
| 1
Modified RANGRF increases the amount of SCN5A. 1 / 1
| 1
reach
"Heterologous expression in HEK293 cells and MOG1 overexpression in neonatal myocytes led to increased expression of SCN5A and peak I Na [XREF_BIBR; XREF_BIBR]."
RANGRF binds SCN5A.
| 1
| 1
sparser
"Co-IP in lysates prepared from mouse neonatal cardiomyocytes also confirmed the association of MOG1 and SCN5A [ xref ]."
RANGRF activates SCN5A.
| 1
Mutated RANGRF activates SCN5A. 1 / 1
| 1
reach
"The MOG1 mutant loss of function appears to cause BrS by decreasing SCN5A trafficking to the cell surface and decreased peak I Na."
PKA affects SCN5A
| 3
PKA activates SCN5A. 3 / 3
| 3
reach
"For example as noted above, we have shown that PKA activation increases trafficking of hH1 into the plasma membrane [10]."
reach
"These were used to localize the structural determinant in the hH1 sequence responsible for PKA modulation of hH1."
reach
"Previous work by us and others has shown that hH1 current is increased by activation of PKA [10,24]."
Notch affects SCN5A
| 3
Notch decreases the amount of SCN5A.
| 2
Notch decreases the amount of SCN5A. 2 / 2
| 2
reach
"Utilizing a genetic mouse model to transiently activate Notch signaling within adult atrial myocardium we found that, in contrast to its effects on ventricular myocardium, transient Notch activation in atrial myocardium reduces Scn5a expression, which encodes the major sodium channel in the heart."
reach
"Notch induction reduces Scn5a expression in the right atrial myocardium, and since mutations within Scn5a have been linked to familial SSS, this is a plausible mechanism for heart rate slowing after transient Notch activation [XREF_BIBR]."
Notch increases the amount of SCN5A.
| 1
Notch increases the amount of SCN5A. 1 / 1
| 1
reach
"Ventricular Notch activation upregulates Scn5a expression, while ectopic Wnt activation downregulates Scn5a expression, consistent with programming to an AV junction like phenotype."
NAV1 affects SCN5A
| 2 1
NAV1 binds SCN5A.
| 2
| 2
sparser
"Most NaV1.5 mutations associated with LQT3 promote a mode of sodium channel gating in which some channels fail to inactivate, contributing to increased late sodium current (INaL), which is directly responsible for delayed repolarization and prolongation of the QT interval."
sparser
"Mutations in the SCN5A gene, which encodes the Nav1.5 protein forming the α subunit of the sodium channel, are common in BrS, accounting for approximately 20% to 25% of cases.[ xref ]In our case, no abnormity in the SCN5A gene was detected."
NAV1 activates SCN5A.
| 1
NAV1 activates SCN5A. 1 / 1
| 1
reach
"However, SCN5A related alterations in sinus node function may be caused by the involvement of Nav1.5 in extracellular matrix remodeling, rather than a primary electrical effect."
MOS affects SCN5A
| 3
MOS decreases the amount of SCN5A.
| 2
MOS decreases the amount of SCN5A. 2 / 2
| 2
reach
"The abnormal cardiac looping detected in mog1 morphants was remarkably similar to that observed in embryos with knockdown of scn5a expression by MOs reported previously XREF_BIBR."
reach
"Conversely, it is likely that knockdown of scn5a expression by MOs may affect the function of Mog1 because both of them interact strongly and may cross-regulate their functions."
MOS increases the amount of SCN5A.
| 1
MOS increases the amount of SCN5A. 1 / 1
| 1
reach
"Conversely, it is likely that knockdown of scn5a expression by MOs may affect the function of Mog1 because both of them interact strongly and may cross-regulate their functions."
L-cysteine affects SCN5A
| 3
L-cysteine activates SCN5A.
| 2
L-cysteine activates SCN5A-C373Y. 1 / 1
| 1
reach
"L-cysteine did not prevent Hg2+ block of hSkM1 (Time50% = 37s) or the C373Y hH1 mutant (Time50% = 43s)."
| 1
reach
"L-cysteine did not prevent the Cd2+ block of hH1."
L-cysteine inhibits SCN5A.
| 1
| 1
reach
"L-cysteine alone blocked hH1 and hSkM1 in a dose dependent manner, with saturating L-cysteine block at 3,000 micromol/L."
IRX3 affects SCN5A
| 3
IRX3 inhibits SCN5A.
| 1
Mutated IRX3 inhibits SCN5A. 1 / 1
| 1
reach
"In HL-1 cells and neonatal mouse ventricular myocytes, IRX3 transfection up-regulated SCN5A and connexin-40 mRNA, which was attenuated by IRX3 mutations."
IRX3 increases the amount of SCN5A.
| 1
IRX3 increases the amount of SCN5A. 1 / 1
| 1
reach
"XREF_BIBR The transfection of WT Irx3 increased the expression of SCN5A mRNA; however, Q485H variant did not increase the SCN5A mRNA expression as much as the WT (XREF_FIG)."
IRX3 activates SCN5A.
| 1
IRX3 activates SCN5A. 1 / 1
| 1
reach
"In HL-1 cells and neonatal mouse ventricular myocytes, IRX3 transfection up-regulated SCN5A and connexin-40 mRNA, which was attenuated by IRX3 mutations."
His-Gly affects SCN5A
| 3
His-Gly activates SCN5A.
| 2
His-Gly activates SCN5A-C373Y. 1 / 1
| 1
reach
"Lower concentrations of Hg 2+ (in the range of 0.1 and 0.3 mu M) did not sufficiently block C373Y hH1 (0.1 mu M, 0%; 0.3 mu M, 11.4 +/- 12%; p < 0.05) in comparison with wild-type hH1 (0.1 mu M, 25 +/- 23%; 0.3 mu M, 42 +/- 17%)."
His-Gly activates SCN5A. 1 / 1
| 1
reach
"The lower concentrations of Hg 2+ (in the range of 0.1 and 0.3 mu M) significantly and selectively blocked hH1 (0.1 mu M, 25 +/- 23%; 0.3 mu M, 42 +/- 17%; p < 0.05) but did not appreciably block hSkM1 (0.1 mu M, 0%; 0.3 mu M, 7 +/- 8%)."
His-Gly inhibits SCN5A.
| 1
His-Gly inhibits SCN5A-C373Y. 1 / 1
| 1
reach
"The low dose of Hg 2+ produced a smaller block of C373Y hH1 (0.1 mu M, 0%; 0.3 mu M, 3%; 1.0 mu M, 19%) than that of wild-type hH1, as shown in Fig. 7."
HDL affects SCN5A
| 3
HDL binds SCN5A and HB1. 2 / 2
| 2
sparser
"DMPC associated specifically with HB1 and HB2, two HDL binding proteins recently identified in rat liver plasma membranes."
sparser
"These results support the findings of a previous study showing that HDL binding activity of both HB1 and HB2, which was determined by ligand blotting using HDL3 as a ligand, were reduced after administering cholesterol lowering agents. (Arteriosclerosis, 10: 1045-1050,1990)."
| 1
sparser
"If the interaction between HDL and HB2 reduces the adhesion-induced inflammatory cellular events that characterize arterial wall injury, thereby achieving the protection associated with higher plasma levels of HDL, these findings may provide a clue to one mitigating effect of HDL in heart disease."
FGF12 affects SCN5A
2 | 1
FGF12 binds SCN5A.
1 | 1
1 | 1
sparser
"We showed that a loss-of-function mutation in FGF12 that eliminates Na + channel modulation is associated with Brugada syndrome, an inherited cardiac arrhythmia[ xref ], and a mutation in the cardiac Na + channel gene SCN5A that affects FGF12 interaction and Na V 1.5 channel function in ventricular myocytes leads to a life-threatening arrhythmia syndrome[ xref ]."
signor
"Sodium channel fast inactivation is modulated by alpha subunit interaction with a family of cytoplasmic proteins termed fibroblast growth factor homologous factors (FHFs). In this paper, we report that all A-type FHFs exert rapid onset long-term inactivation on Nav1.6 and other sodium channels."
FGF12 inhibits SCN5A.
1 |
FGF12 inhibits SCN5A. 1 / 1
1 |
signor
"Sodium channel fast inactivation is modulated by alpha subunit interaction with a family of cytoplasmic proteins termed fibroblast growth factor homologous factors (FHFs). In this paper, we report that all A-type FHFs exert rapid onset long-term inactivation on Nav1.6 and other sodium channels."
EIF2AK3 affects SCN5A
| 3
EIF2AK3 inhibits SCN5A.
| 1
| 1
reach
"Inhibition of PERK prevented full-length SCN5A mRNA degradation and Na + current reduction, suggesting that UPR activation is downstream of variant translation and required for the variant mediated reduction in Na + current."
EIF2AK3 decreases the amount of SCN5A.
| 1
EIF2AK3 decreases the amount of SCN5A. 1 / 1
| 1
reach
"PERK inhibition prevented the loss of full-length SCN5A and K v 4.3 mRNA levels resulting from expressing Na + channel mRNA splice variants."
EIF2AK3 activates SCN5A.
| 1
EIF2AK3 activates SCN5A. 1 / 1
| 1
reach
"PERK causes SCN5A variant mediated downregulation of the full-length SCN5A mRNA."
CDK2 affects SCN5A
1 | 1 1
CDK2 phosphorylates SCN5A.
| 1 1
CDK2 phosphorylates SCN5A. 2 / 2
| 1 1
sparser
"Phosphorylation of HH1 by Cdk2 immunoprecipitates was comparable in extracts from each genotype tested."
reach
"Phosphorylation of HH1 by Cdk2 immunoprecipitates was comparable in extracts from each genotype tested."
CDK2 binds SCN5A.
1 |
1 |
biogrid
No evidence text available
CALM affects SCN5A
| 2 1
| 2 1
sparser
"24 CAV3 plays a role in prolonging action potential by binding to calmodulin, which binds SCN5A and increases its slow-inactivation kinetics in response to regional increase in the concentration of calcium."
sparser
"The IQ/AA mutation eliminated CaM binding to the carboxyl terminus of both micro1 and hH1 channels."
reach
"24 CAV3 plays a role in prolonging action potential by binding to calmodulin, which binds SCN5A and increases its slow inactivation kinetics in response to regional increase in the concentration of calcium."
BS affects SCN5A
| 3
SCN5A binds BS. 3 / 3
| 3
sparser
"Mutation R1193Q has been associated with both LQT3 and BS in the French Canadian population ( Huang et al., 2006 )."
sparser
"To date, 119 SCN5A mutations have been associated with BS ( Fig. 2 )."
sparser
"Mutations in SCN5A associated with the BS phenotype usually result in a loss of channel function by a reduction in Na+ currents."
ATXN3 affects SCN5A
| 3
| 3
sparser
"Brugada syndrome is a life-threatening, inherited arrhythmia disorder associated with autosomal dominant mutations in SCN5A [ xref - xref ], the gene encoding the human cardiac Na + channel α subunit (Nav1.5) [ xref ], which contains four homologous domains, each composed of six membrane-spanning segments, linked by cytoplasmic linkers."
sparser
"Brugada syndrome is a life-threatening, inherited arrhythmia disorder associated with autosomal dominant mutations in SCN5A, the gene encoding the human cardiac Na + channel α subunit (Nav1.5)."
sparser
"Brugada syndrome (BrS) is a life-threatening, inherited arrhythmogenic syndrome associated with autosomal dominant mutations in SCN5A , the gene encoding the cardiac Na + channel alpha subunit (Na v 1.5)."
| 2
sparser
"For example, disrupted association of the SCN5A complex with the sarcomere protein syntrophin has been implicated in a variant of long QT syndrome ( xref )."
sparser
"We propose that syntrophin gamma 2 is an essential Na(+) channel-interacting protein required for the full expression of the Na(+) current and that the SCN5A-syntrophin gamma 2 interaction determines mechanosensitivity and current availability."
Phenytoin affects SCN5A
| 2
Phenytoin activates SCN5A-Q1475P. 2 / 2
| 2
reach
"We previously reported a case of an infant with malignant LQT3 and a missense Q1475P SCN5A variant, who was effectively treated with phenytoin, but only partially with mexiletine."
reach
"We previously reported a case of an infant with malignant LQT3 and a missense Q1475P SCN5A variant, who was effectively treated with phenytoin, but only partially with mexiletine."
Novel NaV1.5 regulator affects SCN5A
| 2
Novel NaV1.5 regulator inhibits SCN5A. 2 / 2
| 2
eidos
"Within this set , a novel NaV1.5 regulator , let-7f , resulted in decreased NaV1.5 expression , current density and reduced motility of GI smooth muscle ."
eidos
"Within this set , a novel NaV1.5 regulator , let-7f , resulted in decreased NaV1.5 expression , current density and reduced motility of GI smooth muscle ."
MiR-219 affects SCN5A
| 2
MiR-219 increases the amount of SCN5A.
| 1
MiR-219 increases the amount of SCN5A. 1 / 1
| 1
reach
"In contrast, miR-219 promotes increased expression of SCN5A, encoding for the pore subunit of the voltage gated sodium channel, probably through indirect targeting of the SCN5A transcripts [XREF_BIBR]."
MiR-219 activates SCN5A.
| 1
MiR-219 activates SCN5A. 1 / 1
| 1
reach
"Particularly, miR-219 increases Scn5a and Nav1.5 transcript and protein expression."
MiR-200a-3p affects SCN5A
| 2
MiR-200a-3p activates SCN5A. 2 / 2
| 2
reach
"We used this expanded cohort to validate the array resultsby RT-qPCR of individual miRNAs.We selected differentially expressed miRNAs that were predicted to target SCN5A : miR-429, and miR-200a-3p from one cluster, and let-7f from the other.We found no difference in expression between the STC and control groups for miR-200a-3p, likely due to low expressionof this miRNA in our samples (XREF_FIG), but we confirmed significant differential expression for let-7f and miR-429 (XREF_FIG - XREF_FIG)."
reach
"We used this expanded cohort to validate the array resultsby RT-qPCR of individual miRNAs.We selected differentially expressed miRNAs that were predicted to target SCN5A : miR-429, and miR-200a-3p from one cluster, and let-7f from the other.We found no difference in expression between the STC and control groups for miR-200a-3p, likely due to low expressionof this miRNA in our samples (XREF_FIG), but we confirmed significant differential expression for let-7f and miR-429 (XREF_FIG - XREF_FIG)."
MiR-192-5p affects SCN5A
| 2
MiR-192-5p decreases the amount of SCN5A. 2 / 2
| 2
reach
"With Western blot assays and electrophysiological studies, we demonstrated that miR-192-5p significantly reduced expression of SCN5A and Nav1.5 as well as peak sodium current density INa generated by Nav1.5."
reach
"For example, inhibitors of miR-192-5p may be used to increase SCN5A expression or enhance density of I Na, and treat patients with down-regulation of SCN5A or reduced I Na density as in AF, heart failure, myocardial ischemia, BrS and other arrhythmias."
Cell death affects SCN5A
| 2
reach
"In this study, we report a de novo mutation in the sodium channel gene SCN5A, which is associated with sudden infant death."
Cell death binds mutated SCN5A. 1 / 1
| 1
reach
"A homozygous SCN5A mutation associated with atrial standstill and sudden death."
Binding 3'UTR affects SCN5A
| 2
Binding 3'UTR activates SCN5A. 2 / 2
| 2
eidos
"Those miRNAs are predicted or previously shown to modulate NaV1.5 expression by binding to the 3'UTR of theSCN5AmRNA ( Fig. 1C ) ."
eidos
"Those miRNAs are predicted or previously shown to modulate NaV1.5 expression by binding to the 3'UTR of theSCN5AmRNA ( Fig. 1C ) ."
| 2
sparser
"The reduction in I Na occurred in association with reduced expression of SCN5a and voltage gated Na + (Na V 1.5) channels as well as a shift in I Na activation kinetics."
sparser
"The reduction in I Na occurred in association with reduced expression of SCN5a and voltage gated Na + (Na V 1.5) channels as well as a shift in I Na activation kinetics."
TNF affects SCN5A
2 |
TNF increases the amount of SCN5A.
1 |
Transcriptionally active TNF increases the amount of SCN5A. 1 / 1
1 |
signor
"TNF-α increases Na(+) currents by accelerating the channel activation as well as increasing the expression of VGSCs in a mechanism dependent upon NF-κB and p38 MAPK signal pathways in CNS neurons. TNF-α increased Na(+) currents by accelerating the activation of VGSCs. The threshold for action potential (AP) was decreased and firing rate were increased. VGSCs were up-regulated at both the mRNA and protein levels."
TNF activates SCN5A.
1 |
TNF activates SCN5A. 1 / 1
1 |
signor
"TNF-α increases Na(+) currents by accelerating the channel activation as well as increasing the expression of VGSCs in a mechanism dependent upon NF-κB and p38 MAPK signal pathways in CNS neurons. TNF-α increased Na(+) currents by accelerating the activation of VGSCs. The threshold for action potential (AP) was decreased and firing rate were increased. VGSCs were up-regulated at both the mRNA and protein levels."
TGFB1 affects SCN5A
| 2
TGFB1 activates SCN5A. 2 / 2
| 2
reach
"At 1 ng/ml TGF-beta1 significantly increased SCN5A (Na V 1.5) (+73%; p < 0.01), while reducing KCNIP2 (Kchip2; -77%; p < 0.01) and KCND2 (K V 4.2; -50% p < 0.05) mRNA levels."
reach
"qPCR analysis demonstrated that at 1 ng/ml TGF-beta1 significantly increased SCN5A (Na V 1.5), while reducing KCNIP2 (KChip2) and KCND2 (K V 4.2) mRNA levels."
SWI/SNF complexes affects SCN5A
| 2
SWI/SNF complexes increases the amount of SCN5A. 2 / 2
| 2
reach
"This strategy is currently being considered as an anticancer strategy in the clinic, but care will need to be taken to avoid double depletion or perturbation of BRG1 and BRM in cardiomyocytes since this would likely result in conduction defects and sudden death.The working model is that BRG1- and BRM catalyzed SWI/SNF complexes directly and indirectly activate the expression of Cx40, Cx43, and Scn5a to maintain conduction."
reach
"The working model is that BRG1- and BRM catalyzed SWI/SNF complexes directly and indirectly activate the expression of Cx40, Cx43, and Scn5a to maintain conduction."
STC1 affects SCN5A
| 2
| 2
reach
"Let-7f and other STC associated miRNAs target GI SMC genes in addition to SCN5A."
reach
"Let-7f and other STC associated miRNAs target GI SMC genes in addition to SCN5A."
SNTB2 affects SCN5A
1 1 |
1 1 |
hprd
No evidence text available
biogrid
No evidence text available
SNTB1 affects SCN5A
1 1 |
1 1 |
biogrid
No evidence text available
hprd
No evidence text available
SGK1 affects SCN5A
| 2
SGK1 activates SCN5A. 2 / 2
| 2
reach
"SCN5A currents were activated by coexpression of either wild-type SGK1 or SGK3 or the constitutively active S422DSGK1."
reach
"SGK1 activates a wide variety of ion channels (e.g., ENaC, SCN5A, TRPV4-6, ROMK, Kv1.3, Kv1.5, Kv4.3, KCNE1 and KCNQ1, KCNQ4, ASIC1, GluR6, ClCKa and barttin, ClC2, CFTR, and Orai and STIM), which participate in the regulation of transport, hormone release, neuroexcitability, inflammation, cell proliferation, and apoptosis."
| 2
reach
"We demonstrate that an intracellular sodium channel variant, human macrophage SCN5A, initiates signaling and transcription through a calcium dependent isoform of adenylate cyclase, ADCY8, and the transcription factor, ATF2."
reach
"Promoter variants of SCN5A may cause interindividual variability in transcription from the wild-type and mutant allele (Yang et al., 2008)."
| 2
sparser
"For example, disrupted association of the SCN5A complex with the sarcomere protein syntrophin has been implicated in a variant of long QT syndrome ( xref )."
sparser
"We propose that syntrophin gamma 2 is an essential Na(+) channel-interacting protein required for the full expression of the Na(+) current and that the SCN5A-syntrophin gamma 2 interaction determines mechanosensitivity and current availability."
SCN5A affects protein mRNA beta-catenin
| 2
SCN5A activates protein mRNA beta-catenin. 2 / 2
| 2
eidos
"In addition , knockdown of Nav1.5 was found to inhibit the protein and mRNA expression levels of beta-catenin , cyclin D1 , and c-Myc in the Wnt / beta-catenin signaling pathway ."
eidos
"In addition , knockdown of Nav1.5 was found to inhibit the protein and mRNA expression levels of beta-catenin , cyclin D1 , and c-Myc in the Wnt / beta-catenin signaling pathway ."
SCN5A affects migration invasion
| 2
SCN5A activates migration invasion. 2 / 2
| 2
eidos
"Transwell assay results showed that knockdown of Nav1.5 effectively suppressed the migration and invasion in OSCC ."
eidos
"Transwell assay results showed that knockdown of Nav1.5 effectively suppressed the migration and invasion in OSCC ."
SCN5A affects migration
| 2
SCN5A activates migration. 2 / 2
| 2
eidos
"Knockdown of Nav1.5 inhibits cell proliferation , migration and invasion via Wnt / beta-catenin signaling pathway in oral squamous cell carcinoma ."
eidos
"Knockdown of Nav1.5 inhibits cell proliferation , migration and invasion via Wnt / beta-catenin signaling pathway in oral squamous cell carcinoma ."
SCN5A affects luciferase reporter
| 2
SCN5A activates luciferase reporter. 2 / 2
| 2
reach
"We first used a luciferase reporter driven by SCN5A 3 ' UTR to determine if let-7f suppresses SCN5A expression.We found that 48 h after transfection, let-7f miRNA mimics decreased normalized luciferase units by 55.9 +/-8.2% (0.169 +/-0.037 NLU) in HEK293 cells co-transfected with let-7f miRNA mimic and SCN5A 3 ' UTR, compared to cells transfected with the 3 ' UTR vector alone (0.406 +/-0.058 NLU; n = 6; p = 0.013, let-7f mimic to no-mimic controls by a two tailed paired t-test, XREF_FIG)."
reach
"We first used a luciferase reporter driven by SCN5A 3 ' UTR to determine if let-7f suppresses SCN5A expression.We found that 48 h after transfection, let-7f miRNA mimics decreased normalized luciferase units by 55.9 +/-8.2% (0.169 +/-0.037 NLU) in HEK293 cells co-transfected with let-7f miRNA mimic and SCN5A 3 ' UTR, compared to cells transfected with the 3 ' UTR vector alone (0.406 +/-0.058 NLU; n = 6; p = 0.013, let-7f mimic to no-mimic controls by a two tailed paired t-test, XREF_FIG)."
SCN5A affects luciferase mRNA
| 2
SCN5A increases the amount of luciferase mRNA.
| 1
SCN5A increases the amount of luciferase mRNA. 1 / 1
| 1
reach
"A putative MEF2C binding site located in the promoter region of SCN5A suggests that MEF2C regulates SCN5A by binding to this site.23 Our results showing that MEF2C was associated with the SCN5A gene and that overexpression of MEF2C enhanced the luciferase mRNA expression driven by the WT SCN5A promoter support this idea."
SCN5A activates luciferase mRNA.
| 1
SCN5A activates luciferase mRNA. 1 / 1
| 1
reach
"A 3.9-fold increase of luciferase mRNA driven by the SCN5A WT promoter was observed with the Mef2C overexpression in RL14 cells compared with those in cells without Mef2C plasmid transfected."
SCN5A affects lidocaine
| 2
Lidocaine binds mutated SCN5A. 1 / 1
| 1
reach
"4,22 None of these SCN5A mutations have been associated with lidocaine induced arrhythmia."
reach
"A Rare Loss-of-Function SCN5A Variant is Associated With Lidocaine induced Ventricular Fibrillation."
SCN5A affects hNav1.5
| 2
SCN5A inhibits hNav1.5.
| 1
SCN5A inhibits hNav1.5. 1 / 1
| 1
reach
"On the other hand, we demonstrated that a common SCN5A single nucleotide polymorphism can enhance use dependent block of hNav1.5 with quinidine, and with the class IC agent flecainide [XREF_BIBR]."
SCN5A activates hNav1.5.
| 1
Mutated SCN5A activates hNav1.5. 1 / 1
| 1
reach
"In LQT3 patients, SCN5A mutations induce ultraslow inactivation of a small fraction of the hNav1.5 current, i.e. persistent Na+ current (IpNa)."
SCN5A affects flecainide
| 2
SCN5A inhibits flecainide.
| 1
| 1
reach
"We observed that SCN5A blocking dibenzazepines, but not the cardiac specific inhibitor flecainide, also enhanced killing of intracellular M.bovis BCG (Fig XREF_FIG), with no adverse cytotoxic effects (Supplementary FigS5), suggesting that SCN5A might be the molecular target of CBZ on macrophages."
SCN5A activates flecainide.
| 1
| 1
reach
"Flecainide, a therapeutic option in a patient with long QT syndrome type 3 caused by the heterozygous V411M mutation in the SCN5A gene."
SCN5A affects delayed transit
| 2
SCN5A inhibits delayed transit. 2 / 2
| 2
eidos
"Since NaV1.5 current density is involved in GI smooth muscle function , where NaV1.5 inhibition leads to constipation and delayed transit , we hypothesized in this study that miRNAs might regulate NaV1.5 density in STC ."
eidos
"Since NaV1.5 current density is involved in GI smooth muscle function , where NaV1.5 inhibition leads to constipation and delayed transit , we hypothesized in this study that miRNAs might regulate NaV1.5 density in STC ."
SCN5A affects cardiomyocyte contractility
| 2
SCN5A activates cardiomyocyte contractility. 2 / 2
| 2
eidos
"It is possible that the let-7f driven decrease in NaV1.5 current density may cause decreased SMC and cardiomyocyte contractility via an imbalance in the function of Na + / K + pump or Na + / Ca2 + exchanger , like in vascular smooth muscle [ 62 ] , ultimately leading to decreased [ Ca2 + ] i. Another possibility is via NaV1.5 role as the central component of a macromolecular complex that contributes to myocyte structure by interacts with structural genes , like syntrophin and telethonin , both in the heart [ 63 ] and GI smooth muscle [ 60,61 ] ."
eidos
"It is possible that the let-7f driven decrease in NaV1.5 current density may cause decreased SMC and cardiomyocyte contractility via an imbalance in the function of Na + / K + pump or Na + / Ca2 + exchanger , like in vascular smooth muscle [ 62 ] , ultimately leading to decreased [ Ca2 + ] i. Another possibility is via NaV1.5 role as the central component of a macromolecular complex that contributes to myocyte structure by interacts with structural genes , like syntrophin and telethonin , both in the heart [ 63 ] and GI smooth muscle [ 60,61 ] ."
SCN5A affects betA1
| 2
| 2
reach
"These results indicate that hH1 and the b2 subunit are transported separately to the plasma membrane whereas the hH1 and beta1 complex occurs already within the ER, which possibly facilitates trafficking of the channel complex to the plasma membrane."
reach
"A study using over-expression of fluorescent tagged SCN5A, beta1, and beta2 in HEK293 cells suggested that SCN5A and beta2 are transported separately to the plasma membrane while SCN5A and beta1 form a complex in the endoplasmic reticulum (ER) that may facilitate plasma membrane trafficking XREF_BIBR."
| 2
reach
"For instance, depletion of hH1.2 induces apoptosis in MCF7 cells, which are p53-positives, while it results in G1 arrest in T47D cells, which are p53 negative."
reach
"LQTS Mutation N1325S in Cardiac Sodium Channel Gene SCN5A Causes Cardiomyocyte Apoptosis, Cardiac Fibrosis and Contractile Dysfunction in Mice."
SCN5A affects activity
| 2
SCN5A inhibits activity. 2 / 2
| 2
sparser
"Indeed, our previous studies have shown that FoxO1 reduces Na V 1.5 expression in vitro by binding to the SCN5a promoter and inhibiting its activity in HL-1 cardiomyocytes [ xref ]."
sparser
"In this study, we demonstrated that Foxo1 directly targeted the SCN5a promoter and inhibited its transcriptional activity."
| 2
sparser
"The reduction in I Na occurred in association with reduced expression of SCN5a and voltage gated Na + (Na V 1.5) channels as well as a shift in I Na activation kinetics."
sparser
"The reduction in I Na occurred in association with reduced expression of SCN5a and voltage gated Na + (Na V 1.5) channels as well as a shift in I Na activation kinetics."
SCN5A affects TBX5
| 1 1
SCN5A inhibits TBX5.
| 1
SCN5A inhibits TBX5. 1 / 1
| 1
reach
"Scn5a, Gja1, Dsp, Ryr2, and Atp2a2 were significantly dysregulated genes in both Tbx5 and Pitx2 deletion models."
SCN5A binds TBX5.
| 1
SCN5A binds TBX5 and PGR. 1 / 1
| 1
sparser
"In meta-analyses of P-wave duration, we identified 6 significant ( P <5×10 - 8 ) novel loci and replicated a prior association with S CN10A. We identified 3 loci at SCN5A , TBX5 , and CAV1/CAV2 that were jointly associated with the PR interval, PR segment, and P-wave duration."
SCN5A affects TBX3
| 2
| 1
sparser
"Chromatin immunoprecipitation showed that Wnt signalling inhibits Scn5a expression through downstream mediator (TCF4) binding to both Tbx3 and Scn5a promoters."
SCN5A binds TBX3 and TCF4. 1 / 1
| 1
sparser
"Strategies to block TCF4 binding to the Tbx3 and Scn5a promoters would represent novel strategies for cardiac-specific inhibition of the Wnt pathway to rescue I Na and prevent sudden cardiac deaths."
| 2
sparser
"11 In addition, the ethnic-specific common cardiac sodium channel polymorphism S1103Y-SCN5A has been associated with African American SIDS and sudden cardiac death in young black adults."
sparser
"In addition, the ethnic-specific common cardiac sodium channel polymorphism S1103Y-SCN5A has been associated with African American SIDS and sudden cardiac death in young black adults [ xref , xref , xref ], reinforcing the hypothesis that genetic issues may be strikingly involved in SIDS."
SCN5A affects STC1
| 2
| 2
reach
"Let-7f and other STC associated miRNAs target GI SMC genes in addition to SCN5A."
reach
"Let-7f and other STC associated miRNAs target GI SMC genes in addition to SCN5A."
SCN5A affects SSS
| 2
SCN5A binds SSS.
| 1
| 1
reach
"XREF_BIBR - XREF_BIBR Recent reports of mutational analyses have revealed more than 200 distinct mutations in SCN5A, of which at least 20 mutations are associated with SSS."
SCN5A activates SSS.
| 1
SCN5A activates SSS. 1 / 1
| 1
reach
"However, some SCN5A gain-of-function mutations cause SSS by prolonging the sinus node action potential and disrupting its complete repolarization, which in turn, leads to a reduction in sinus rate [60]."
SCN5A affects SNTB2
1 1 |
1 1 |
hprd
No evidence text available
biogrid
No evidence text available
SCN5A affects SNTB1
1 1 |
1 1 |
biogrid
No evidence text available
hprd
No evidence text available
SCN5A affects PITX2
| 1 1
SCN5A inhibits PITX2.
| 1
SCN5A inhibits PITX2. 1 / 1
| 1
reach
"Scn5a, Gja1, Dsp, Ryr2, and Atp2a2 were significantly dysregulated genes in both Tbx5 and Pitx2 deletion models."
SCN5A binds PITX2.
| 1
sparser
"The rs2200733 has been associated with expression of PITX2 , which is a transcription factor, and the expression level of PITX2 has been associated with structural changes as well as expression of ion channel genes such as SCN5A [ xref ]."
SCN5A affects Na+ channel
| 2
SCN5A inhibits Na+ channel.
| 1
SCN5A inhibits Na+ channel. 1 / 1
| 1
reach
"Induction of SCN5a variants by angiotensin II or hypoxia activates the UPR to down-regulate the Na+ channel activity, all of which is prevented by inhibiting PERK [XREF_BIBR], demonstrating the causal relationship between these SCN5a variants, the UPR, and Na+ channel activity."
SCN5A activates Na+ channel.
| 1
SCN5A activates Na+ channel. 1 / 1
| 1
reach
"Induction of SCN5a variants by angiotensin II or hypoxia activates the UPR to down-regulate the Na+ channel activity, all of which is prevented by inhibiting PERK [XREF_BIBR], demonstrating the causal relationship between these SCN5a variants, the UPR, and Na+ channel activity."
SCN5A affects NEDD4L
2 |
2 |
hprd
No evidence text available
hprd
No evidence text available
SCN5A affects NEDD4
2 |
2 |
biogrid
No evidence text available
biogrid
No evidence text available
SCN5A affects Lu-HH1
| 2
SCN5A inhibits Lu-HH1. 2 / 2
| 2
reach
"The survival of the mice treated with 800 MBq/kg 177 Lu-HH1 was significantly lower than for mice treated with HH1 or 400 MBq/kg 177 Lu-HH1 (p < 0.04), but not for mice treated with NaCl (p = 0.053)."
reach
"In contrast, the blood counts at euthanasia for mice treated with 800 and 1000 MBq/kg 177 Lu-HH1 were significantly lower than for mice treated with NaCl and HH1 (p < 0.05) (XREF_FIG B)."
SCN5A affects LQT3 [
| 2
Mutated SCN5A activates LQT3 [. 1 / 1
| 1
reach
"To re-investigate this latter point and potentially assess pharmacological response profiles, we have established a patient derived hiPSC model harbouring a heterozygous SCN5A mutation (p.R1644H) mutation that is known to cause LQT3 [XREF_BIBR]."
SCN5A activates LQT3 [. 1 / 1
| 1
reach
"Mutations in Scn5a causing increased late I Na have been implicated to cause LQT3 [XREF_BIBR], and mutations causing decreased peak and early I Na have been implicated to cause a number of syndromes, including BrS, idiopathic ventricular fibrillation (IVF), cardiac conduction disease (CCD), sick sinus syndrome (SSS), and familial atrial fibrillation (FAF) [XREF_BIBR; XREF_BIBR]."
SCN5A affects LQT2
| 2
SCN5A activates LQT2. 2 / 2
| 2
reach
"LQT1, LQT2, and LQT3 are caused by mutations in KCNQ1 (LQT1), KCNH2 (LQT2), and SCN5A (LQT3), which account for approximately 90% of genotyped LQTS patients."
reach
"Among them most common are LQT1, LQT2, and LQT3, caused by mutations in KCNQ1, KCNH2, and SCN5A genes, respectively (Splawski etal."
SCN5A affects GATA4
| 2
SCN5A increases the amount of GATA4. 2 / 2
| 2
reach
"Recent studies have shown that the zinc-finger transcription factor, GATA4, and the myocyte enhancing factor-2C (MEF2C) enhances SCN5A transcription."
reach
"Recent studies have shown that the zinc-finger transcription factor, GATA4, and the myocyte enhancing factor-2C (MEF2C) enhances SCN5A transcription."
SCN5A affects ERs
| 2
SCN5A binds ERs. 2 / 2
| 2
sparser
"In the present study, we identified and characterized a novel sodium channel, voltage gated, type V alpha subunit ( SCN5A ) mutation that was associated with ERS."
sparser
"It was reported that mutations in SCN5A were associated with Type 3 ERS under baseline conditions or following a sodium block challenge ( xref )."
SCN5A affects EIF2AK3
| 2
SCN5A activates EIF2AK3. 2 / 2
| 2
reach
"We tested whether the presence of SCN5A splice variants could induce PERK."
reach
"Overexpression of full-length SCN5A did not upregulate PERK, however (XREF_SUPPLEMENTARY)."
SCN5A affects DYM
| 2
SCN5A activates DYM. 2 / 2
| 2
eidos
"It is possible that the let-7f driven decrease in NaV1.5 current density may cause decreased SMC and cardiomyocyte contractility via an imbalance in the function of Na + / K + pump or Na + / Ca2 + exchanger , like in vascular smooth muscle [ 62 ] , ultimately leading to decreased [ Ca2 + ] i. Another possibility is via NaV1.5 role as the central component of a macromolecular complex that contributes to myocyte structure by interacts with structural genes , like syntrophin and telethonin , both in the heart [ 63 ] and GI smooth muscle [ 60,61 ] ."
eidos
"It is possible that the let-7f driven decrease in NaV1.5 current density may cause decreased SMC and cardiomyocyte contractility via an imbalance in the function of Na + / K + pump or Na + / Ca2 + exchanger , like in vascular smooth muscle [ 62 ] , ultimately leading to decreased [ Ca2 + ] i. Another possibility is via NaV1.5 role as the central component of a macromolecular complex that contributes to myocyte structure by interacts with structural genes , like syntrophin and telethonin , both in the heart [ 63 ] and GI smooth muscle [ 60,61 ] ."
| 2
| 2
eidos
"Since NaV1.5 current density is involved in GI smooth muscle function , where NaV1.5 inhibition leads to constipation and delayed transit , we hypothesized in this study that miRNAs might regulate NaV1.5 density in STC ."
eidos
"Since NaV1.5 current density is involved in GI smooth muscle function , where NaV1.5 inhibition leads to constipation and delayed transit , we hypothesized in this study that miRNAs might regulate NaV1.5 density in STC ."
SCN5A affects CFH
| 2
SCN5A activates CFH. 2 / 2
| 2
reach
"SCN5A variants expression was increased with higher NYHA class, consistent with the notion that these patients exhibit worsening HF symptoms and are at higher risk from HF complications such as arrhythmias."
reach
"Their data suggest that even modest depression of SCN5A expression may promote pathologic cardiac remodeling and progression of HF."
SCN5A affects CD4
| 2
SCN5A activates CD4. 2 / 2
| 2
reach
"In vivo shRNA knockdown of Scn5a specifically inhibited positive selection of CD4 + T cells."
reach
"Thus, shRNA knockdown of Scn5a significantly decreased development of CD4 + T cells in B6 mice, establishing the importance of a VGSC in positive selection in vivo."
SCN5A affects ANK3
| 1 1
SCN5A decreases the amount of ANK3.
| 1
Modified SCN5A decreases the amount of ANK3. 1 / 1
| 1
reach
"In rat cardiomyocytes with ankyrin-G expression reduced by siRNA, total SCN5A expression, plasma membrane localization, and I Na were reduced, without an effect on kinetics [XREF_BIBR]."
SCN5A binds ANK3.
| 1
| 1
sparser
"A mutation in SCN5A (E1053K) discovered in a patient with BrS disrupts association of SCN5A with ankyrin-G, resulting in decreased I Na [ xref ]."
| 2
reach
"Subsequently, genetic testing identified 1 base pair deletion mutation in the SCN5A, which causes a frame shift and truncates the hNa v 1.5 starting at amino acid 1397, where truncation in the domain III pore loop would be expected to produce a nonfunctional hNa v 1.5."
reach
"SCN5A variants may cause unpredictable hNa v 1.5 response to antiarrythmic agents."
SCD affects SCN5A
| 1 1
| 1 1
sparser
"Of the 27 candidate SNPs, one SNP (rs11720524) located in intron 1 of SCN5A which was previously associated with SCD was significantly associated with VF caused by first STEMI."
reach
"Of the 27 candidate SNPs, one SNP (rs11720524) located in intron 1 of SCN5A which was previously associated with SCD was significantly associated with VF caused by first STEMI."
RNA-binding affects SCN5A
| 2
RNA-binding increases the amount of SCN5A. 2 / 2
| 2
reach
"We have shown that RNA binding protein, HuR, positively regulates SCN5A mRNA expression by protecting SCN5A mRNA from degradation in vitro."
reach
"Conclusions : Our study results indicate that RNA binding protein HuR can positively regulate cardiac sodium channel SCN5A expression in vivo and can reduce arrhythmia risk in heart failure."
RMB25 affects SCN5A
| 2
RMB25 inhibits SCN5A.
| 1
RMB25 inhibits SCN5A. 1 / 1
| 1
reach
"The activated RMB25 and LUC7L3 splicing complex increases SCN5A C (VC) and D (VD) variants, decreases the full-length SCN5A transcript and protein, and decreases Na + current."
RMB25 activates SCN5A.
| 1
RMB25 activates SCN5A. 1 / 1
| 1
reach
"The activated RMB25 and LUC7L3 splicing complex increases SCN5A C (VC) and D (VD) variants, decreases the full-length SCN5A transcript and protein, and decreases Na + current."
RAS affects SCN5A
| 1 1
RAS increases the amount of SCN5A.
| 1
RAS increases the amount of SCN5A. 1 / 1
| 1
reach
"It appears that cardiac specific RAS dysregulation causing changes in SCN5A and gap junction protein levels may be associated with non familial SSS."
RAS binds SCN5A.
| 1
| 1
sparser
"It appears that cardiac-specific RAS dysregulation causing changes in SCN5A and gap junction protein levels may be associated with non-familial SSS."
NUP107 affects SCN5A
| 1 1
NUP107 increases the amount of SCN5A.
| 1
Modified NUP107 increases the amount of SCN5A. 1 / 1
| 1
reach
"Overexpression of Nup107 induced the protein expression of Scn5a rather than that of other ion channels, with no effects of their mRNA levels."
NUP107 binds SCN5A.
| 1
| 1
sparser
"Using RIP-PCR and luciferase assay, we found that the 5'-UTR of Scn5a mRNA was not involved in the interaction, whereas the spatial interaction between Nup107 protein and Scn5a mRNA was formed when Scn5a mRNA passing through the nuclear pore."
NTRK3 affects RYR2, SCN5A, bop, and type 3
| 2
RYR2 binds SCN5A, NTRK3, bop, and type 3. 2 / 2
| 2
sparser
"The four core genes causing IPAS are KCNQ1 associated with long QT syndrome type 1 (LQTS1), KCNH2 associated with long QT syndrome type 2 (LQTS2), SCN5A associated with long QT syndrome type 3 (LQTS3) or BrS and RYR2 associated with CPVT."
sparser
"The four core genes causing IPAS are KCNQ1 associated with long QT syndrome type 1 (LQTS1), KCNH2 associated with long QT syndrome type 2 (LQTS2), SCN5A associated with long QT syndrome type 3 (LQTS3) or BrS and RYR2 associated with CPVT."
NOS1 affects SCN5A, and SNTA1
| 2
SCN5A binds SNTA1 and NOS1. 2 / 2
| 2
sparser
"Based on the associations of nNOS, SNTA1, PMCA4b [ xref ] and SNTA1 with SCN5A [ xref ], the full complex ( xref ) was demonstrated in mouse heart by co-IP [ xref ]."
sparser
"We also performed immunoprecipitation with FLAG antibody using a FLAG-tagged SCN5A co-expressed with nNOS, SNTA1, and Cav3 (WT, F97C, or vector) in HEK cells and found that the complex remained intact with the mutant Cav3 ( xref ) Taken together, these results demonstrate that nNOS, SCN5A and SNTA1 form a complex with Cav3 in the heart."
NKX2-5 affects SCN5A
| 1 1
NKX2-5 increases the amount of SCN5A.
| 1
NKX2-5 increases the amount of SCN5A. 1 / 1
| 1
reach
"Relatively rapid and progressive reduction of Na v 1.5 (alpha) expression in Nkx2-5 knockout hearts suggests that transcription of Scn5a may be directly regulated by Nkx2-5 in most ventricles."
NKX2-5 activates SCN5A.
| 1
NKX2-5 activates SCN5A. 1 / 1
| 1
sparser
"Similar to the other atrial working myocardial genes such as Nppa and Cx40, Scn5a is directly activated by Nkx2–5 and Tbx5, but repressed by Tbx3 [ xref , xref , xref ]."
NEDD4 affects SCN5A
2 |
2 |
biogrid
No evidence text available
biogrid
No evidence text available
MicroRNAs affects SCN5A
| 2
| 2
eidos
"Those miRNAs are predicted or previously shown to modulate NaV1.5 expression by binding to the 3'UTR of theSCN5AmRNA ( Fig. 1C ) ."
eidos
"Those miRNAs are predicted or previously shown to modulate NaV1.5 expression by binding to the 3'UTR of theSCN5AmRNA ( Fig. 1C ) ."
MYH6 affects PGR, and SCN5A
| 2
SCN5A binds MYH6 and PGR. 2 / 2
| 2
sparser
"Rare variations in MYH6 and SCN5A are associated with PR interval."
sparser
"Variation in two gene regions, MYH6 ( P = 5.9×10 −11 ) and SCN5A ( P = 1.1×10 −7 ), was associated with PR interval ( xref ). xref show the association of each rare variant within MYH6 and SCN5A with PR interval, respectively."
Let-7f affects SCN5A
| 2
Modified Let-7f decreases the amount of SCN5A. 2 / 2
| 2
reach
"Let-7f overexpression in HuSMCs significantly reduced SCN5A expression, Na V 1.5 current density, and cellular contractility."
reach
"Let-7f overexpression in HuSMCs significantly reduced SCN5A expression, Na V 1.5 current density, and cellular contractility."
ITGA9 affects MEIS1, PGR, SCN5A, SLC8A1, and SOX5
| 2
| 2
sparser
"Among the 13 candidate genes, SLC8A1, MEIS1, ITGA9, SCN5A , and SOX5 associated with the PR interval."
sparser
"Among 13 PR interval candidate genes, SLC8A1, MEIS1, ITGA9, SCN5A , and SOX5 associated with the PR interval."
IL6ST affects SCN5A
| 2
IL6ST activates SCN5A. 2 / 2
| 2
reach
"Moreover, the activation of gp130 by CT-1 increased SCN5A mRNA only in SOCS3 cKO cardiomyocytes (XREF_FIG)."
reach
"To examine whether the gp130 activation directly increases SCN5A mRNA, we stimulated isolated WT and SOCS3 cKO cardiomyocytes with CT-1."
HB1 affects HDL, and SCN5A
| 2
HDL binds SCN5A and HB1. 2 / 2
| 2
sparser
"DMPC associated specifically with HB1 and HB2, two HDL binding proteins recently identified in rat liver plasma membranes."
sparser
"These results support the findings of a previous study showing that HDL binding activity of both HB1 and HB2, which was determined by ligand blotting using HDL3 as a ligand, were reduced after administering cholesterol lowering agents. (Arteriosclerosis, 10: 1045-1050,1990)."
GJA5 affects LMNA, SCN1B, SCN5A, and TRPM4
| 2
| 2
sparser
"In this study we focused solely on the relevant 19 PCCD genes including SCN5A , SCN1B , TRPM4 , GJA5 and LMNA that have already been associated with isolated cardiac conduction defects together with GJA1 , GJC1 , SCN10A , NKX2-5 , TBX5 , SNTA1 , PRKAG2 , RYR2 , EMD , BMP2 , BMPR1A , GATA4 , MSX2 and TNNI3K as likely candidate genes."
sparser
"Nineteen genes known or suspected to be involved in conduction defects were sequenced in these patients using the HaloPlex™ System, resulting in a mean coverage depth of 578 × per sample: SCN5A , SCN1B , TRPM4 , GJA5 and LMNA that have already been associated with isolated cardiac conduction defects together with GJA1 , GJC1 , SCN10A , NKX2-5 , TBX5 , SNTA1 , PRKAG2 , RYR2 , EMD , BMP2 , BMPR1A , GATA4 , MSX2 and TNNI3K . A graphical representation of the mean coverage obtained for the 5 major genes is provided in Supplemental Fig. 1 ."
GATA4 affects SCN5A
| 2
GATA4 increases the amount of SCN5A. 2 / 2
| 2
reach
"Recent studies have shown that the zinc-finger transcription factor, GATA4, and the myocyte enhancing factor-2C (MEF2C) enhances SCN5A transcription."
reach
"Recent studies have shown that the zinc-finger transcription factor, GATA4, and the myocyte enhancing factor-2C (MEF2C) enhances SCN5A transcription."
FGF14 affects SCN5A
2 |
FGF14 inhibits SCN5A.
1 |
FGF14 inhibits SCN5A. 1 / 1
1 |
signor
"Sodium channel fast inactivation is modulated by alpha subunit interaction with a family of cytoplasmic proteins termed fibroblast growth factor homologous factors (FHFs). In this paper, we report that all A-type FHFs exert rapid onset long-term inactivation on Nav1.6 and other sodium channels."
FGF14 binds SCN5A.
1 |
1 |
signor
"Sodium channel fast inactivation is modulated by alpha subunit interaction with a family of cytoplasmic proteins termed fibroblast growth factor homologous factors (FHFs). In this paper, we report that all A-type FHFs exert rapid onset long-term inactivation on Nav1.6 and other sodium channels."
FGF13 affects SCN5A
2 |
FGF13 inhibits SCN5A.
1 |
FGF13 inhibits SCN5A. 1 / 1
1 |
signor
"Sodium channel fast inactivation is modulated by alpha subunit interaction with a family of cytoplasmic proteins termed fibroblast growth factor homologous factors (FHFs). In this paper, we report that all A-type FHFs exert rapid onset long-term inactivation on Nav1.6 and other sodium channels."
FGF13 binds SCN5A.
1 |
1 |
signor
"Sodium channel fast inactivation is modulated by alpha subunit interaction with a family of cytoplasmic proteins termed fibroblast growth factor homologous factors (FHFs). In this paper, we report that all A-type FHFs exert rapid onset long-term inactivation on Nav1.6 and other sodium channels."
FGF11 affects SCN5A
2 |
FGF11 inhibits SCN5A.
1 |
FGF11 inhibits SCN5A. 1 / 1
1 |
signor
"Sodium channel fast inactivation is modulated by alpha subunit interaction with a family of cytoplasmic proteins termed fibroblast growth factor homologous factors (FHFs). In this paper, we report that all A-type FHFs exert rapid onset long-term inactivation on Nav1.6 and other sodium channels."
FGF11 binds SCN5A.
1 |
1 |
signor
"Sodium channel fast inactivation is modulated by alpha subunit interaction with a family of cytoplasmic proteins termed fibroblast growth factor homologous factors (FHFs). In this paper, we report that all A-type FHFs exert rapid onset long-term inactivation on Nav1.6 and other sodium channels."
ERs affects SCN5A
| 2
SCN5A binds ERs. 2 / 2
| 2
sparser
"In the present study, we identified and characterized a novel sodium channel, voltage gated, type V alpha subunit ( SCN5A ) mutation that was associated with ERS."
sparser
"It was reported that mutations in SCN5A were associated with Type 3 ERS under baseline conditions or following a sodium block challenge ( xref )."
ENPP2 affects SCN5A
| 2
ENPP2 inhibits SCN5A.
| 1
ENPP2 inhibits SCN5A. 1 / 1
| 1
reach
"ATX II slows the inactivation phase of hH1 with little or no effect on activation."
ENPP2 activates SCN5A.
| 1
ENPP2 activates SCN5A. 1 / 1
| 1
reach
"XREF_FIG shows that in ND7/23 cells, application of the sodium channel opener ATX-II augments Nav1.5-mediated sodium current but that this augmented current is not highly sensitive to A-803467 : ATX augmented SCN5A mediated late current was no more sensitive to A-803467 than was peak current (50% block at ~ 5000 nM)."
Camk2d affects SCN5A
2 |
Camk2d phosphorylates SCN5A on S516. 1 / 1
1 |
biopax:phosphositeplus
No evidence text available
Camk2d phosphorylates SCN5A on T594. 1 / 1
1 |
biopax:phosphositeplus
No evidence text available
CXXC1 affects SCN5A
| 2
CXXC1 methylates SCN5A. 2 / 2
| 2
sparser
"The methylation pattern analysis revealed that all of the CpG sites were completely methylated in HB1."
sparser
"The R558 (CGC) may be more prone to being methylated than H558 (CAC) and may be related to a suppressive modification of the SCN5A promoter CpG island methylation."
CREBZF affects CTCF, and SCN5A
| 2
| 2
sparser
"ChIP with this antibody showed that the ZF-Sss1 binds to these two CTCF sites ( xref , lanes 1 and 2)."
sparser
"In lentivirus-infected cells, however, the expressed ZF-Sss1 bound to CTCF sites in the CpG1 island of the paternal allele and induced de novo DNA methylation in the paternal Kcnq1ot1 promoter ( xref , middle and bottom)."
CLOCK affects SCN5A
| 2
CLOCK increases the amount of SCN5A.
| 1
CLOCK increases the amount of SCN5A. 1 / 1
| 1
reach
"We conclude that disruption of the molecular clock in the adult heart slows heart rate, increases arrhythmias, and decreases the functional expression of Scn5a."
CLOCK activates SCN5A.
| 1
CLOCK activates SCN5A. 1 / 1
| 1
reach
"A weak oscillator in U2OS cells can only in part explain the low number of robustly cycling genes in U2OS cells since the U2OS clock is sufficiently strong to support transcription rhythms of the ATG3, EIF5A2, and SCN5A reporters with absolute amplitudes (peak - trough) equal or higher than those of the BMAL1 and PER2 promoters."
CFH affects SCN5A
| 2
CFH inhibits SCN5A.
| 1
CFH inhibits SCN5A. 1 / 1
| 1
reach
"Full length SCN5A mRNA was reduced by 0.6-fold in HF tissue (P < 0.05, XREF_FIG), a result similar to our previous report."
CFH activates SCN5A.
| 1
CFH activates SCN5A. 1 / 1
| 1
reach
"Human heart failure (HF) increases alternative mRNA splicing of the SCN5A cardiac Na + channel, generating variants encoding truncated, nonfunctional channels that are trapped in the endoplasmic reticulum."
CAV3 affects NOS1, SCN5A, and SNTA1
| 1 1
SCN5A binds SNTA1, CAV3, and NOS1. 2 / 2
| 1 1
sparser
"To demonstrate interactions between SCN5A with SNTA1, nNOS and Cav3, co-IP experiments in rat heart homogenates were performed using nNOS antibody to immunoprecipitate the complex and specific antibodies to detect SCN5A, SNTA1, and Cav3 from the complex (F igure 3E )."
reach
"Cav3-F97C increased peak and late I Na by nNOS dependent S nitrosylation of SCN5A through the SCN5A, SNTA1, nNOS, and Cav3 complex."
Arg-Val affects SCN5A
| 2
Arg-Val activates SCN5A. 2 / 2
| 2
reach
"The electrophysiological experiments demonstrated (1) increased arrhythmic tendency with RVOT as opposed to RV stimulation in Scn5a +/-, but not WT hearts."
reach
"In conclusion, arrhythmic tendency was increased specifically with RVOT as opposed to RV stimulation in Scn5a +/- but not WT hearts."
AKT affects SCN5A
| 2
AKT phosphorylates SCN5A.
| 1
AKT phosphorylates SCN5A. 1 / 1
| 1
reach
"Induction of constitutively active p110alpha in the heart of adult mice increased Akt phosphorylation and mRNA levels of both the alpha (Scn5a) and beta (Scn1b) subunits of the cardiac sodium channel."
AKT decreases the amount of SCN5A.
| 1
AKT decreases the amount of SCN5A. 1 / 1
| 1
reach
"XREF_BIBR - XREF_BIBR A recent study has indicated that FOXO1 negatively regulates SCN5A transcription, XREF_BIBR and effect that can be inhibited by Akt induced phosphorylation and translocation of FOXO1 from the nucleus to the cytoplasm."
Wild-type beta1 affects SCN5A
| 1
Wild-type beta1 activates SCN5A. 1 / 1
| 1
reach
"XREF_BIBR In our experiments, wild-type beta1 increased SCN5A currents and modulated channel gating, and the p.R85H and p.D153N mutants showed loss of beta1 function with significantly decreased current amplitudes."
Tx affects SCN5A
| 1
Tx inhibits SCN5A. 1 / 1
| 1
reach
"Following pre-incubation of cells with the PKC-beta-specific inhibitor LY379196, Tx still caused marked suppression of hH1 current (reduction of I Na in the presence of LY379196 0.1 mM did not differ significantly from Tx alone, Fig. 2A)."
| 1
| 1
reach
"The voltage gated sodium channel family is comprised of ten members : SCN1A (Nav1.1), SCN2A (Nav1.2; SCN2A1 in mouse), SCN3A (Nav1.3), SCN4A (Nav1.4), SCN8A (Nav1.6), and SCN9A (Nav1.7) are blocked by tetrodotoxin, whereas SCN5A (Nav1.5), SCN7A (Nax), SCN10A (Nav1.8), and SCN11A (Nav1.9) are not blocked by tetrodotoxin [XREF_BIBR, XREF_BIBR, XREF_BIBR]."
Sev affects SCN5A
| 1
Sev increases the amount of mutated SCN5A. 1 / 1
| 1
reach
"This result indicates that, in the absence of the second 45degrees rotation, the hh 1 mutation failed to cause an overrotation defect in the first 45degrees rotation.When sca was overexpressed in the posterior region of wild-type eye discs by sev-GAL4, ommatidial clusters displayed an underrotation defect, with many of them finishing the first stage of rotation and arresting at 40degrees-45degrees."
Response to hypoxia affects SCN5A
1 |
Response to hypoxia increases the amount of SCN5A. 1 / 1
1 |
bel
"Gene expression profiles of LX-2 cells induced by hypoxia were obtained by using cDNA microarray technique."
Pyridine affects SCN5A
| 1
| 1
reach
"We did not observe any reductions in SCN5A mRNA abundances when SCN5A cells were transfected with WT or A280V GPD1-L or treated with extracellular pyridine nucleotides."
PntAB affects SCN5A
| 1
PntAB activates SCN5A. 1 / 1
| 1
sparser
"In this addendum to our study, we report our observations that 1) the linker between domains I and II (L DI-DII ) of Na V 1.5 contains a nuclear localization signal (residues 474-481) that is necessary to localize L DI-DII into the nucleus, and 2) nuclear L DI-DII activates the SCN5A promoter in gene reporter assays using cardiac-like H9c2 cells."
Papain affects SCN5A
| 1
Papain activates SCN5A. 1 / 1
| 1
reach
"Internal papain perfusion removed fast inactivation from each isoform and caused a 20-mV hyperpolarizing shift in hH1 V (a), with an insignificant change in rSkM1 V (a)."
Pan-PI3K inhibitor affects SCN5A
| 1
Pan-PI3K inhibitor inhibits SCN5A. 1 / 1
| 1
reach
"Chronic exposure (10-100 nM; 5-48 hours) to PI3K- alpha -specific subunit inhibitors BYL710 (alpelisib) and A66 and a pan-PI3K inhibitor (BKM120) increased I NaL in SCN5A -transfected CHO cells and mouse cardiomyocytes."
P50 subunit affects SCN5A
| 1
P50 subunit inhibits SCN5A. 1 / 1
| 1
reach
"Overexpression of the p50 subunit of NF-kappaB in H9c2 cells reduced scn5a mRNA (77.3%, P < 0.01)."
P.A257G-SNTA1 affects SCN5A
| 1
SCN5A binds p.A257G-SNTA1. 1 / 1
| 1
reach
"18 This study demonstrated that p.A257G-SNTA1 can functionally interact with SCN5A in HEK293 cells without requiring nNOS or PMCA4b."
Nuclear factor affects SCN5A
| 1
SCN5A binds nuclear factor. 1 / 1
| 1
reach
"Gel shift and chromosomal immunoprecipitation assays confirmed that nuclear factor (NF)-kappaB bound to the scn5a promoter in response to ANG II and H (2) O (2)."
Nuclear L DI-DII affects SCN5A
| 1
Nuclear L DI-DII activates SCN5A. 1 / 1
| 1
reach
"In this addendum to our study, we report our observations that 1) the linker between domains I and II (L DI-DII) of Na V 1.5 contains a nuclear localization signal (residues 474-481) that is necessary to localize L DI-DII into the nucleus, and 2) nuclear L DI-DII activates the SCN5A promoter in gene reporter assays using cardiac like H9c2 cells."
Nicorandil affects SCN5A
| 1
| 1
reach
"The K (ATP) channel-opener nicorandil (20muM) significantly reduced arrhythmic incidence in Langendorff perfused Scn5a +/Delta hearts during programmed electrical stimulation; wild-types (WTs) showed a total absence of arrhythmogenicity."
Nal affects SCN5A
| 1
SCN5A binds nal. 1 / 1
| 1
sparser
"This positive feedback from Na + to Ca 2 + to CaMKII to Na + has been qualitatively described for Na + loading induced by ATX-II or accompanying a LQT3 mutation associated with increased I NaL ( xref )."
Myc epitope affects SCN5A
| 1
Myc epitope activates SCN5A. 1 / 1
| 1
reach
"The construct used in this study had a myc epitope fused to the N-terminus of SCN5A protein so that we might regard antibody that recognized myc as the one that target SCN5A."
Mu 1 channels affects SCN5A
| 1
Mu 1 channels activates SCN5A. 1 / 1
| 1
reach
"If this type of sequential movement of S4 segments occurred, then the activation phenotype of mu 1 (1) hH1 (2-4) should have resembled the activation of hH1 channels rather than mu 1 channels."
Monensin A affects SCN5A
| 1
| 1
reach
"Chloroquine and monensin, compounds that disrupt plasma membrane recycling, reduced hH1 current, suggesting rapid turnover of channels at the cell surface."
MiR-24 affects SCN5A
| 1
MiR-24 decreases the amount of SCN5A. 1 / 1
| 1
reach
"Here, we show that miR-24 potently suppresses SCN5A expression and that rs1805126 modulates this regulation."
MiR-192-5p mimics affects SCN5A
| 1
MiR-192-5p mimics decreases the amount of SCN5A. 1 / 1
| 1
reach
"First, luciferase assays from Luc-SCN5A-3 '-UTR reporter genes with the miR-192-5p binding site showed that miR-192-5p mimics significantly decreased the expression of SCN5A by 3.3-fold compared with negative control miRNA mimics (XREF_FIG)."
Methyl affects SCN5A
| 1
Methyl increases the amount of SCN5A. 1 / 1
| 1
reach
"The protein arginine methyl transferases (PRMT) -3 and -5 was reported to methylate SCN5A in vitro and increase SCN5A cell surface expression and Na + current density [XREF_BIBR]."
| 1
Lipopolysaccharide decreases the amount of SCN5A. 1 / 1
| 1
reach
"LPS of 0.1 and 1microg/ml reduced the expression level of SCN5A (Na + channel, Nav1.5, Fig."
Lamotrigine affects SCN5A
| 1
| 1
reach
"Lacosamide, carbamazepine, and lamotrigine all inhibit the cardiac sodium channel SCN5A in a concentration dependent manner XREF_BIBR."
1 |
Transcriptionally active hsa-miR-192-5p decreases the amount of SCN5A. 1 / 1
1 |
biopax:mirtarbase
No evidence text available
| 1
| 1
reach
"As for other sulfo-amino acids, homocysteine prevented the Hg2+ block of hH1, with the Time50% (70s) being significantly smaller than that of L-cysteine, whereas methionine did not prevent the Hg2+ block of hH1."
Hh3 affects SCN5A
| 1
| 1
sparser
"Thirty-four candidate haplotypes (p<10(-4)) including previously reported regions associated with Brachyspina, CVM, HH1, and HH3 in Holstein breed were identified."
Glycerol-3-phosphate dehydrogenase 1-like gene affects SCN5A
| 1
Glycerol-3-phosphate dehydrogenase 1-like gene inhibits SCN5A. 1 / 1
| 1
reach
"Recently, a novel mutation in the glycerol-3-phosphate dehydrogenase 1 like gene (GPD1-L) disrupted trafficking of SCN5A in a multigenerational family with BrS."
Fatty acid affects SCN5A
| 1
| 1
sparser
"The effects of single amino acid point mutations on fatty acid-induced inhibition of the hH1(alpha) Na(+) current (I(Na)) were assessed."
Failure affects SCN5A
| 1
Failure activates SCN5A. 1 / 1
| 1
reach
"Human heart failure (HF) increases alternative mRNA splicing of the SCN5A cardiac Na + channel, generating variants encoding truncated, nonfunctional channels that are trapped in the endoplasmic reticulum."
| 1
reach
"In addition the optimal ECM promoted hypertrophic growth of cardiomyocytes and the expression of key mature sarcolemmal (SCN5A, Kir2.1 and Connexin43) and myofilament markers (cTroponin I)."
Exon-25 affects SCN5A
| 1
Exon-25 activates SCN5A. 1 / 1
| 1
reach
"Screening of exon-25 led to the identification of IVS25 +65 G> A in intron-25 of SCN5A. '"
| 1
Dexamethasone increases the amount of SCN5A. 1 / 1
| 1
reach
"SCN5A expression was not increased by dexamethasone (XREF_SUPPLEMENTARY), and the inhibitor did not significantly affect any other aspect of the AP, together supporting this specific mechanistic explanation."
Cocaine(1+) affects SCN5A
| 1
| 1
reach
"Cocaine block of hH1 channels was greater than block of mu1 channels at voltages between -120 mV and -90 mV, suggesting that greater steady-state inactivation of hH1 channels in this voltage range makes them more susceptible to cocaine block."
Cisapride affects SCN5A
| 1
| 1
reach
"Nevertheless, those studies firmly identify the Na V 1.5 cardiac sodium channel as an important mediator of diLQTS and fit with prior studies, such as Makita et al., which observed that subclinical mutations (L1825P) in the LQTS related gene SCN5A might predispose certain individuals to diLQTS when treated with the prokinetic drug cisapride, a K + channel blocking agent."
Chloroquine affects SCN5A
| 1
| 1
reach
"Chloroquine and monensin, compounds that disrupt plasma membrane recycling, reduced hH1 current, suggesting rapid turnover of channels at the cell surface."
Cas9 affects SCN5A
| 1
Cas9 increases the amount of SCN5A. 1 / 1
| 1
reach
"CRISPR and Cas9 mediated correction of the mutation re-establishes sodium current density and SCN5A expression."
| 1
reach
"Lacosamide, carbamazepine, and lamotrigine all inhibit the cardiac sodium channel SCN5A in a concentration dependent manner XREF_BIBR."
Calcium(2+) affects SCN5A
| 1
reach
"proposed a novel mechanism for modulation of Na channel function where Ca ions bind directly to hH1 via an EF-hand motif in the C-terminal domain."
Beta adrenergic receptor affects SCN5A
| 1
Beta adrenergic receptor activates SCN5A. 1 / 1
| 1
reach
"In previous studies, beta adrenergic receptor stimulation was reported to increase current densities of caveolar SCN5A (Frohnwieser et al., 1997; Palygin et al., 2008)."
Beta 1 -subunit affects SCN5A
| 1
Beta 1 -subunit activates SCN5A. 1 / 1
| 1
reach
"Furthermore, the beta 1 -subunit modulates completion of slow inactivation in hSkM1 but not hH1 sodium channels.hSkM1 and hH1 sodium channels were constructed as previously described (Featherstone et al., 1996; Richmond et al., 1998)."
| 1
sparser
"They found that in phagocytes, CBZ inhibits the sodium-dependent inositol transporter SCN5A. Blockade of this transporter decreased the intracellular pools of inositol leading to a concomitant decrease in PIP 2 and IP 3 that reduces mitochondrial Ca 2+ and ATP levels."
| 1
| 1
reach
"However, with chronic (24hour) exposure, azithromycin caused a ~ 2-fold increase in both peak and late SCN5A currents, with findings confirmed for I Na in cardiomyocytes."
Amlodipine affects SCN5A
| 1
| 1
reach
"Amlodipine produced tonic blockade of hH1 in a concentration dependent manner with 1 : 1 stoichiometry, and phasic blockade of hH1 which was dependent on the pulse duration."
| 1
reach
"Block of human heart hH1 sodium channels by amitriptyline."
WWP2 affects SCN5A
1 |
1 |
biogrid
No evidence text available
VF affects SCN5A
| 1
| 1
sparser
"Of the 27 candidate SNPs, one SNP (rs11720524) located in intron 1 of SCN5A which was previously associated with SCD was significantly associated with VF caused by first STEMI."
VCL-M94I affects SCN5A
| 1
VCL-M94I inhibits SCN5A. 1 / 1
| 1
reach
"These results suggest that VCL-M94I does n't disrupt the physical association of VCL and SCN5A."
TCEA1 affects SCN5A
| 1
| 1
sparser
"This study confirmed that pharmacological manipulation of VGSC activity led to changes in both ERK1/2 activity and chromatin binding of ERK-regulated TFs to SCN5A -dependent genes."
T-box affects SCN5A
| 1
T-box increases the amount of SCN5A. 1 / 1
| 1
reach
"However, others report minimal expression of Scn10a in the heart and ascribe its association with conduction abnormalities to an intragenic T-box enhancer that modulates expression of the nearby Scn5a gene [XREF_BIBR]."
SiRNA-beta-catenin affects SCN5A
| 1
SiRNA-beta-catenin inhibits SCN5A. 1 / 1
| 1
reach
"As shown in XREF_FIG, SiRNA-beta-catenin significantly increased SCN5a promoter activity, compared to scramble SiRNA and H 2 O 2 significantly decreased SCN5a promoter activity, compared to the control group; H 2 O 2 inhibitory effect on the SCN5a promoter activity was completely abolished by beta-catenin SiRNA."
STAT3 affects SCN5A
| 1
STAT3 increases the amount of SCN5A. 1 / 1
| 1
reach
"21 The inhibition of STAT3 activation significantly decreased SCN5A mRNA level both at baseline and 4 hours post CT-1 stimulation (XREF_FIG, right panel)."
SSS affects SCN5A
| 1
| 1
reach
"XREF_BIBR - XREF_BIBR Recent reports of mutational analyses have revealed more than 200 distinct mutations in SCN5A, of which at least 20 mutations are associated with SSS."
SNTG2 affects SCN5A
1 |
1 |
hprd
No evidence text available
SNP affects SCN5A
| 1
| 1
sparser
"In another recent study, Park et al demonstrated that within a multigenerational BrS/overlapping phenotype pedigree harboring the truncating Q646RfsX5-SCN5A mutation, those individuals, who also harbored a 2-SNP minor haplotype (rs41310749 and rs41310239) in the SCN5A promoter on both the mutant and normal SCN5A alleles (i.e. homozygous for the minor alleles), had a severe arrhythmia phenotype (defined as suffering from syncope, OHCA, or SCD) in comparison to the mild arrhythmia phenotype (defined as no cardiac events) displayed by those Q646RfsX5-positive individuals who only inherited the 2-SNP haplotype on their mutant SCN5A allele.[ xref ] Interestingly, in comparison to the wild-type 2-SNP SCN5A promoter haplotype, previous in vitro studies conducted in a variety of cell types displayed a trend towards reduced promoter activity associated with the minor 2-SNP SCN5A promoter haplotype.[ xref ] As such, Park et al hypothesized that the modest reduction in both mutant and normal SCN5A expression associated with the minor 2-SNP promoter haplotype functioned in an additive manner to aggravate the underlying arrhythmia phenotype associated with the Q646RfsX5 loss-of-function mutation.[ xref ]"
SLC6A8 affects SCN5A
| 1
SLC6A8 activates SCN5A. 1 / 1
| 1
reach
"Moreover, the activation of gp130 by CT-1 increased SCN5A mRNA only in SOCS3 cKO cardiomyocytes (XREF_FIG)."
SLC4A1 affects SCN5A
| 1
SLC4A1 activates SCN5A. 1 / 1
| 1
sparser
"In this addendum to our study, we report our observations that 1) the linker between domains I and II (L DI-DII ) of Na V 1.5 contains a nuclear localization signal (residues 474-481) that is necessary to localize L DI-DII into the nucleus, and 2) nuclear L DI-DII activates the SCN5A promoter in gene reporter assays using cardiac-like H9c2 cells."
SGK3 affects SCN5A
| 1
SGK3 activates SCN5A. 1 / 1
| 1
reach
"SCN5A currents were activated by coexpression of either wild-type SGK1 or SGK3 or the constitutively active S422DSGK1."
SELENOP affects SCN5A
| 1
| 1
sparser
"Wang et al. reported SCN5A mutations associated with congenital cardiac arrhythmia and LQTS ( xref )."
SCPL24 affects SCN5A
| 1
| 1
sparser
"BrS1 is associated with mutations in SCN5A."
SCN5A-H558R affects SCN5A
| 1
SCN5A-H558R activates SCN5A. 1 / 1
| 1
reach
"However, in the presence of the pathogenic mutation (SCN5A -M1766L), which affects trafficking and I Na expression levels, SCN5A-H558R restores function of the SCN5A channel [8]."
SCN5A affects type-3 LQTS
| 1
SCN5A activates type-3 LQTS. 1 / 1
| 1
reach
"The N1325S mutation in the cardiac sodium channel gene SCN5A has been previously shown to cause type-3 LQTS (LQT3) in both humans and mice."
| 1
Modified SCN5A increases the amount of pyridoxamine. 1 / 1
| 1
reach
"The decreased PM expression of Na v 1.5 was not caused by decreased SCN5A gene expression since the total amounts of SCN5A mRNA and Na v 1.5 protein did not decrease significantly in the cells (XREF_FIG)."
| 1
| 1
reach
"An alternative DCM causing mechanism is cardiomyocyte acidification induced by a mutation in SCN5A that causes an H + leak through the mutated channel [73]."
SCN5A affects p.A257G-SNTA1
| 1
SCN5A binds p.A257G-SNTA1. 1 / 1
| 1
reach
"18 This study demonstrated that p.A257G-SNTA1 can functionally interact with SCN5A in HEK293 cells without requiring nNOS or PMCA4b."
SCN5A affects nuclear factor
| 1
SCN5A binds nuclear factor. 1 / 1
| 1
reach
"Gel shift and chromosomal immunoprecipitation assays confirmed that nuclear factor (NF)-kappaB bound to the scn5a promoter in response to ANG II and H (2) O (2)."
SCN5A affects new challenges reporting outcomes
| 1
SCN5A activates new challenges reporting outcomes. 1 / 1
| 1
eidos
"IVF has created new challenges for reporting outcomes , in which it is difficult for one success rate alone to convey both the effectiveness and safety of a procedure ( Braakhekkeet al ., 2015 ) ."
SCN5A affects nal
| 1
SCN5A binds nal. 1 / 1
| 1
sparser
"This positive feedback from Na + to Ca 2 + to CaMKII to Na + has been qualitatively described for Na + loading induced by ATX-II or accompanying a LQT3 mutation associated with increased I NaL ( xref )."
SCN5A affects maleic acid
| 1
Mutated SCN5A activates maleic acid. 1 / 1
| 1
reach
"SCN5A mutations in BrS increase the risk of MAE in Asian populations, symptomatic BrS patients, and individuals with spontaneous type-1 Brugada pattern."
SCN5A affects long QT syndrome (LQTS) variant 3
| 1
SCN5A activates long QT syndrome (LQTS) variant 3. 1 / 1
| 1
reach
"Genetic lesions in SCN5A can cause congenital long QT syndrome (LQTS) variant 3 (LQT-3) in adults by disrupting inactivation of the Na v 1.5 channel."
| 1
reach
"H. heilmannii type 1 (Hh1), a spiral bacterium that infects the stomach of both man and pigs, easily colonises and induces an inflammatory response in the gastric mucosa of rodents."
SCN5A affects hh3
| 1
| 1
sparser
"Thirty-four candidate haplotypes (p<10(-4)) including previously reported regions associated with Brachyspina, CVM, HH1, and HH3 in Holstein breed were identified."
SCN5A affects growth
| 1
SCN5A inhibits growth. 1 / 1
| 1
sparser
"Synthesis of rice Hb1 inhibited the recombinant E. coli TB1 growth similarly (∼37%) to the synthesis of soybean Lb a , cowpea LbII and Vitreoscilla Hb."
| 1
reach
"We observed that SCN5A blocking dibenzazepines, but not the cardiac specific inhibitor flecainide, also enhanced killing of intracellular M.bovis BCG (Fig XREF_FIG), with no adverse cytotoxic effects (Supplementary FigS5), suggesting that SCN5A might be the molecular target of CBZ on macrophages."
SCN5A affects cocaine
| 1
| 1
reach
"Thedatafor and hH1 are scaled to approximately the same amplitude to allow comparison of cocaine block after conditioning pulses (as labeled) of different amplitude."
SCN5A affects buffalo embryos
| 1
SCN5A activates buffalo embryos. 1 / 1
| 1
eidos
"Several laboratories have produced buffalo embryos by IVF ."
| PMC
SCN5A affects atrial standstill
| 1
Mutated SCN5A inhibits atrial standstill. 1 / 1
| 1
reach
"More rarely, loss-of-function SCN5A mutations cause progressive cardiac conduction disease XREF_BIBR, atrial standstill XREF_BIBR, atrioventricular (AV) block XREF_BIBR, or sinus node disease XREF_BIBR."
SCN5A affects amfR-amfA- amfB
| 1
SCN5A activates amfR-amfA- amfB. 1 / 1
| 1
reach
"The aerial mycelium negative phenotype of strain HH1 was also suppressed by pSPO1 carrying amfR-amfA- amfB (Ueda et al., 1993)."
SCN5A affects ZNF365
| 1
SCN5A activates ZNF365. 1 / 1
| 1
reach
"[XREF_BIBR - XREF_BIBR] Similar scenarios could also be seen in cases of acquired long QT syndrome and ischemic cardiomyopathy, in which rare variants (KCNH2, KCNE1, KCNE2, KCNQ2, SCN5A, and RyR2 in drug induced long QT syndrome and CASQ2, RAB3GAP1, ZNF365, CXADR, GPC5, GPD1L, NOS1AP, and SCN5A in ischemic cardiomyopathy) were associated with higher risk of malignant arrhythmia and SCD."
SCN5A affects WWP2
1 |
1 |
biogrid
No evidence text available
SCN5A affects VT/VF
| 1
SCN5A activates VT/VF. 1 / 1
| 1
reach
"Since I Na (SCN5A) has been shown to cause VT/VF in humans (in the long QT syndrome) this gene certainly is worthy of study."
SCN5A affects VF
| 1
| 1
sparser
"Of the 27 candidate SNPs, one SNP (rs11720524) located in intron 1 of SCN5A which was previously associated with SCD was significantly associated with VF caused by first STEMI."
SCN5A affects VERP
| 1
SCN5A activates VERP. 1 / 1
| 1
reach
"The Scn5a +/- genotype caused an independent increase of VERP regardless of whether the recording site was the RVOT or RV."
SCN5A affects VCS
| 1
SCN5A increases the amount of VCS. 1 / 1
| 1
reach
"We identified a TBX5 responsive enhancer downstream of Scn5a sufficient to drive VCS expression in vivo, dependent on canonical T-box binding sites."
SCN5A affects UPR
| 1
SCN5A activates UPR. 1 / 1
| 1
reach
"SCN5A splice variants activate UPR."
SCN5A affects UDB
| 1
SCN5A activates UDB. 1 / 1
| 1
reach
"Conclusion : A common SCN5A polymorphism R1193Q enhances UDB by propafenone and predisposes the patients to drug induced BrS with PIP treatment."
SCN5A affects TCEA1
| 1
| 1
sparser
"This study confirmed that pharmacological manipulation of VGSC activity led to changes in both ERK1/2 activity and chromatin binding of ERK-regulated TFs to SCN5A -dependent genes."
SCN5A affects TBX3, and TCF4
| 1
SCN5A binds TBX3 and TCF4. 1 / 1
| 1
sparser
"Strategies to block TCF4 binding to the Tbx3 and Scn5a promoters would represent novel strategies for cardiac-specific inhibition of the Wnt pathway to rescue I Na and prevent sudden cardiac deaths."
SCN5A affects Sodium_channels, and bop
| 1
sparser
"In 15–20% of BrS patients, the syndrome is associated with mutations in the SCN5A gene encoding the cardiac Na V 1.5 sodium channel [ xref – xref ]."
SCN5A affects ST6GALNAC2
| 1
Modified SCN5A decreases the amount of ST6GALNAC2. 1 / 1
| 1
reach
"We propose that A3 inhibits hh-1, and that in the absence of A3 the high-level transcription of hh-1 in turn increases the transcription of ST6galnac1, ST6galnac2 and Mxra7."
SCN5A affects ST6GALNAC1
| 1
Modified SCN5A increases the amount of ST6GALNAC1. 1 / 1
| 1
reach
"We propose that A3 inhibits hh-1, and that in the absence of A3 the high-level transcription of hh-1 in turn increases the transcription of ST6galnac1, ST6galnac2 and Mxra7."
SCN5A affects SNTG2
1 |
1 |
hprd
No evidence text available
SCN5A affects SNP
| 1
| 1
sparser
"In another recent study, Park et al demonstrated that within a multigenerational BrS/overlapping phenotype pedigree harboring the truncating Q646RfsX5-SCN5A mutation, those individuals, who also harbored a 2-SNP minor haplotype (rs41310749 and rs41310239) in the SCN5A promoter on both the mutant and normal SCN5A alleles (i.e. homozygous for the minor alleles), had a severe arrhythmia phenotype (defined as suffering from syncope, OHCA, or SCD) in comparison to the mild arrhythmia phenotype (defined as no cardiac events) displayed by those Q646RfsX5-positive individuals who only inherited the 2-SNP haplotype on their mutant SCN5A allele.[ xref ] Interestingly, in comparison to the wild-type 2-SNP SCN5A promoter haplotype, previous in vitro studies conducted in a variety of cell types displayed a trend towards reduced promoter activity associated with the minor 2-SNP SCN5A promoter haplotype.[ xref ] As such, Park et al hypothesized that the modest reduction in both mutant and normal SCN5A expression associated with the minor 2-SNP promoter haplotype functioned in an additive manner to aggravate the underlying arrhythmia phenotype associated with the Q646RfsX5 loss-of-function mutation.[ xref ]"
SCN5A affects SND
| 1
Mutated SCN5A activates SND. 1 / 1
| 1
reach
"2,4 Moreover, loss of function of I Na in the atrium may lead to a failure of impulse conduction from the sinus node into the adjacent myocardium (exit block), which may be a plausible mechanism of SND caused by SCN5A mutations 6 and may also form the substrate for the reentry of supraventricular arrhythmias, such as AT."
SCN5A affects SLC4A1
| 1
SCN5A inhibits SLC4A1. 1 / 1
| 1
reach
"The limiting DI value at which conduction velocity fell to zero (DI limit (theta)) at high heart rates was increased by flecainide in Scn5a +/- RV epicardium and corresponding endocardium (from 16.57 (17.89) to 44.66 (22.16) ms; U = 9.0, P = 0.004, r = 0.65, and from 14.55 (11.75) to 40.10 (18.99) ms; U = 1.0, P = 0.005, r = 0.81)."
SCN5A affects SELENOP
| 1
| 1
sparser
"Wang et al. reported SCN5A mutations associated with congenital cardiac arrhythmia and LQTS ( xref )."
SCN5A affects SCPL24
| 1
| 1
sparser
"BrS1 is associated with mutations in SCN5A."
SCN5A affects SBE1
| 1
| 1
sparser
"Apparent amylose content, alkali digestion value, setback viscosity, and pasting temperature were associated with SBE1 , SSS1 , and SSS2A . Peak viscosity was associated with SBE1 , SBE3 , GBSS1 , and SSS1 ."
SCN5A affects RIPK1
| 1
Mutated SCN5A leads to the methylation of RIPK1. 1 / 1
| 1
reach
"Mutation of hH1 by repeat induced point mutation (RIP) did not result in detectable defects in morphology, DNA methylation, mutagen sensitivity, DNA repair, fertility, RIP, chromosome pairing, or chromosome segregation."
SCN5A affects RGS3
1 |
1 |
hprd
No evidence text available
SCN5A affects RGS2
1 |
1 |
hprd
No evidence text available
SCN5A affects RANGRF
| 1
| 1
sparser
"Co-IP in lysates prepared from mouse neonatal cardiomyocytes also confirmed the association of MOG1 and SCN5A [ xref ]."
SCN5A affects RANGAP1
| 1
SCN5A activates RANGAP1. 1 / 1
| 1
reach
"Thus, SD was prolonged by the Scn5a +/DeltaKPQ genotype but not by age."
SCN5A affects RAB3GAP1
| 1
| 1
reach
"[XREF_BIBR - XREF_BIBR] Similar scenarios could also be seen in cases of acquired long QT syndrome and ischemic cardiomyopathy, in which rare variants (KCNH2, KCNE1, KCNE2, KCNQ2, SCN5A, and RyR2 in drug induced long QT syndrome and CASQ2, RAB3GAP1, ZNF365, CXADR, GPC5, GPD1L, NOS1AP, and SCN5A in ischemic cardiomyopathy) were associated with higher risk of malignant arrhythmia and SCD."
SCN5A affects Pro-Gln
| 1
SCN5A activates Pro-Gln. 1 / 1
| 1
reach
"On 24-hour continuous telemetry and surface ECG recordings, Scn5a (1798insD/+) heterozygous mice showed significantly lower heart rates, more bradycardic episodes (pauses> or = 500 ms), and increased PQ interval, QRS duration, and QTc interval compared with wild-type mice."
SCN5A affects PROTEIN
| 1
SCN5A binds PROTEIN. 1 / 1
| 1
trips
"The major cardiac voltage-gated sodium channel Nav1.5 associates with proteins that regulate its biosynthesis, localization, activity and degradation."
SCN5A affects PPP1R10
| 1
| 1
reach
"Simultaneous expression of human macrophage SCN5A and SCN10A was required to decrease expression of the retained intron and increase protein expression of PPP1R10."
SCN5A affects PKP2
| 1
| 1
sparser
"In a subsequent study on cultured cardiomyocytes (Sato et al., xref ), it was shown that PKP2 associates with the SCN5A encoded sodium channel protein Na V 1.5 and that knockdown of PKP2 expression alters the properties of the sodium current."
SCN5A affects PCCD
| 1
Mutated SCN5A activates PCCD. 1 / 1
| 1
reach
"Moreover, a single SCN5A mutation may cause PCCD alone (isolated) or PCCD combined with BrS (overlap syndrome) [XREF_BIBR, XREF_BIBR]."
SCN5A affects PATJ
1 |
1 |
hprd
No evidence text available
SCN5A affects Na+ channels
| 1
SCN5A activates Na+ channels. 1 / 1
| 1
reach
"However, the N406S mutation in SCN5A causes distinct gating defects and enhanced intermediate inactivation of Na+ channels, which led to unexpected pharmacological effects of lidocaine in a patient carrying this mutation."
SCN5A affects NUP107
| 1
| 1
sparser
"Using RIP-PCR and luciferase assay, we found that the 5'-UTR of Scn5a mRNA was not involved in the interaction, whereas the spatial interaction between Nup107 protein and Scn5a mRNA was formed when Scn5a mRNA passing through the nuclear pore."
SCN5A affects NRPS3
| 1
| 1
sparser
"In detail, we found that Asp83B can modify its conformation to stably form a previously uncharacterized H-bond Hb2 interaction with the right-hand side (RHS) of Cpd1 and Cpd2, while Asp83D locks the NBTIs linker through the crucial H-bond Hb1."
SCN5A affects NOS1AP
| 1
SCN5A activates NOS1AP. 1 / 1
| 1
reach
"[XREF_BIBR - XREF_BIBR] Similar scenarios could also be seen in cases of acquired long QT syndrome and ischemic cardiomyopathy, in which rare variants (KCNH2, KCNE1, KCNE2, KCNQ2, SCN5A, and RyR2 in drug induced long QT syndrome and CASQ2, RAB3GAP1, ZNF365, CXADR, GPC5, GPD1L, NOS1AP, and SCN5A in ischemic cardiomyopathy) were associated with higher risk of malignant arrhythmia and SCD."
SCN5A affects MXRA7
| 1
Modified SCN5A decreases the amount of MXRA7. 1 / 1
| 1
reach
"We propose that A3 inhibits hh-1, and that in the absence of A3 the high-level transcription of hh-1 in turn increases the transcription of ST6galnac1, ST6galnac2 and Mxra7."
SCN5A affects MBNL2
| 1
SCN5A decreases the amount of MBNL2. 1 / 1
| 1
reach
"RT-PCR analysis shows that inclusion of the exon 6A of Scn5a is increased in heart samples of mice with no Mbnl1 and reduced level of Mbnl2 (Mbnl1 -/-, Mbnl2 +/-) (XREF_FIG)."
SCN5A affects MAP6
| 1
SCN5A activates MAP6. 1 / 1
| 1
reach
"Direct sequencing of the KCNH2, KCNQ1 and SCN5A genes revealed a novel heterozygous frameshift mutation in the sixth exon of the KCNH2 gene producing a premature STOP codon : c. 1232_1234delinsTTTGAA (p.Asp411Valfs * 2)."
SCN5A affects Long QT Syndrome 811 Orita
| 1
Mutated SCN5A binds Long QT Syndrome 811 Orita. 1 / 1
| 1
reach
"SCN5A Mutations Associated with Long QT Syndrome 811 Orita, M., Iwahana, H., Kanazawa, H., and Sekiya, T. (1989)."
SCN5A affects Long QT Syndrome 807 Table 2
| 1
Mutated SCN5A binds Long QT Syndrome 807 Table 2. 1 / 1
| 1
reach
"SCN5A Mutations Associated with Long QT Syndrome 807 Table 2."
SCN5A affects LQTS3
| 1
SCN5A activates LQTS3. 1 / 1
| 1
reach
"XREF_BIBR, XREF_BIBR, XREF_BIBR Late I Na can be enhanced by congenital mutations in SCN5A that cause LQTS3, by SCN5A polymorphisms (Y1102 and Y1103), or by acquired cardiac pathologies such as heart failure, myocardial hypertrophy, and ischemia."
SCN5A affects LQTS type 3
| 1
SCN5A activates LQTS type 3. 1 / 1
| 1
reach
"LQTS type 3 (LQT3) is caused by gain-of-function mutations in the SCN5A gene."
SCN5A affects LQTS
| 1
SCN5A activates mutated LQTS. 1 / 1
| 1
reach
"Alternative SCN5A splicing potentiates LQTS mutation severity."
SCN5A affects LQT variant 3
| 1
SCN5A activates LQT variant 3. 1 / 1
| 1
reach
"LQT variant 3 (LQT-3) is caused by mutations in SCN5A, the gene coding for the alpha subunit (Na V 1.5) of the primary cardiac voltage gated Na + channel in the human heart."
SCN5A affects LQT type 3
| 1
SCN5A activates LQT type 3. 1 / 1
| 1
reach
"LQT type 3 (LQT3) syndrome is caused by mutations in the SCN5A gene that encodes Nav1.5."
SCN5A affects Kir2
| 1
SCN5A increases the amount of Kir2. 1 / 1
| 1
isi
"We further found that oxidant stress-induced down-regulation of early growth response protein 1 (EGR1) contributed to I Na and I K1 reduction in post-infarcted hearts, and FGF21 may recruit EGR1 into the SCN5A and KCNJ2 promoter regions to up-regulate Na V 1.5 and Kir2.1 expression at transcriptional level."
SCN5A affects KCN
| 1
| 1
sparser
"We have also demonstrated that mutations in HERG, a SCN5A Mutations Associated with Long QT Syndrome 8O9 putative cardiac potassium channel gene, cause the chro- mosome 7-1inked form of LQT (Curran et al., 1995)."
SCN5A affects K v 4.3
| 1
SCN5A increases the amount of K v 4.3. 1 / 1
| 1
reach
"Our study supports this hypothesis in showing higher mRNA and protein expression of KChIP2 in the RV than LV of WT and Scn5a +/- hearts, which could act to increase RV expression of K v 4.3."
SCN5A affects IVF
| 1
Mutated SCN5A activates IVF. 1 / 1
| 1
reach
"In fact, XREF_BIBR suggested that SCN5A mutations that were responsible for a 25-30% faster recovery rate at a -80 mV recovery potential might cause IVF."
SCN5A affects ITLN1
| 1
SCN5A activates ITLN1. 1 / 1
| 1
reach
"Foxo1 binds the promoter region of SCN5A [XREF_BIBR], and exogenous Foxo1 expression decreases SCN5A promoter activity in HL-1 cells [XREF_BIBR]."
SCN5A affects HLA-B
| 1
| 1
sparser
"She later tested positive for class I deleterious mutation of SCN5A Thr1709Met ( xref ), which has been associated with prior cases of BrS. (; accessed on 11/4/2015)."
SCN5A affects Gly-Ile
| 1
SCN5A activates Gly-Ile. 1 / 1
| 1
reach
"Subsequent functional and animal studies confirmed the importance of SCN5A in GI motility, 86 and SCN5A variants are now thought to underlie human GI syndromes, 87 including reports of overlapping GI and BrS phenotypes."
SCN5A affects GPC5
| 1
SCN5A activates GPC5. 1 / 1
| 1
reach
"[XREF_BIBR - XREF_BIBR] Similar scenarios could also be seen in cases of acquired long QT syndrome and ischemic cardiomyopathy, in which rare variants (KCNH2, KCNE1, KCNE2, KCNQ2, SCN5A, and RyR2 in drug induced long QT syndrome and CASQ2, RAB3GAP1, ZNF365, CXADR, GPC5, GPD1L, NOS1AP, and SCN5A in ischemic cardiomyopathy) were associated with higher risk of malignant arrhythmia and SCD."
SCN5A affects GJ
| 1
SCN5A decreases the amount of GJ. 1 / 1
| 1
reach
"Finally, Scn5a +/- hearts show fibrosis and reduced connexin expression that worsens with age [XREF_BIBR], in line with similar clinical findings [XREF_BIBR]."
SCN5A affects GFP
| 1
SCN5A activates GFP. 1 / 1
| 1
sparser
"Conversely, activation of GFP and endogenously silenced genes by HH1 and other CDK inhibitors was completely prevented by overexpression of P-TEFb (CDK9 + Cyclin T1) ( xref and xref )."
SCN5A affects GAN
1 |
1 |
biogrid
No evidence text available
SCN5A affects FGF14
1 |
1 |
signor
"Sodium channel fast inactivation is modulated by alpha subunit interaction with a family of cytoplasmic proteins termed fibroblast growth factor homologous factors (FHFs). In this paper, we report that all A-type FHFs exert rapid onset long-term inactivation on Nav1.6 and other sodium channels."
SCN5A affects FGF13
1 |
1 |
signor
"Sodium channel fast inactivation is modulated by alpha subunit interaction with a family of cytoplasmic proteins termed fibroblast growth factor homologous factors (FHFs). In this paper, we report that all A-type FHFs exert rapid onset long-term inactivation on Nav1.6 and other sodium channels."
SCN5A affects FGF11
1 |
1 |
signor
"Sodium channel fast inactivation is modulated by alpha subunit interaction with a family of cytoplasmic proteins termed fibroblast growth factor homologous factors (FHFs). In this paper, we report that all A-type FHFs exert rapid onset long-term inactivation on Nav1.6 and other sodium channels."
SCN5A affects FGF
| 1
SCN5A inhibits FGF. 1 / 1
| 1
reach
"SCN5A variant that blocks fibroblast growth factor homologous factor regulation causes human arrhythmia."
SCN5A affects ERBB2
| 1
SCN5A increases the amount of ERBB2. 1 / 1
| 1
trips
"Two nontransformed human mammary epithelial cell lines, the HB2 and the HB2(ErbB2) (the HB2 engineered to overexpress ErbB2), displayed an opposite response to HRG-mediated regulation."
SCN5A affects EF-hand
| 1
| 1
sparser
"Wingo et al. ( xref ) proposed a novel mechanism for modulation of Na channel function where Ca ions bind directly to hH1 via an EF-hand motif in the C-terminal domain."
SCN5A affects DMD
| 1
| 1
reach
"Cav3, SNTA1, and SCN5A also bind to dystrophin, the protein that causes Duchenne and Becker muscular dystrophy with DCM or LVNC, as does SAP97."
SCN5A affects DLG4
1 |
1 |
hprd
No evidence text available
SCN5A affects DLG3
1 |
1 |
hprd
No evidence text available
SCN5A affects DLG2
1 |
1 |
hprd
No evidence text available
SCN5A affects DLG1
1 |
1 |
hprd
No evidence text available
SCN5A affects Cry1Ab-Cry1Ac hybrid toxin
| 1
SCN5A activates Cry1Ab-Cry1Ac hybrid toxin. 1 / 1
| 1
reach
"Previous and current field tests demonstrate that the transgenic rice line Huahui 1 (HH1) producing a Cry1Ab-Cry1Ac hybrid toxin from the bacterium Bacillus thuringiensis reduces egg and larval densities of C. suppressalis but not of S. inferens."
SCN5A affects Congenital long QT syndrome type 3
| 1
SCN5A activates Congenital long QT syndrome type 3. 1 / 1
| 1
reach
"Congenital long QT syndrome type 3 (LQT3) is caused by mutations in the gene SCN5A encoding the alpha-subunit of the cardiac Na (+) channel (Nav1.5)."
| 1
sparser
"In our study, prostate cancer cell viability was significantly inhibited by HB1."
SCN5A affects Cardiac Conduction Disease
| 1
SCN5A activates Cardiac Conduction Disease. 1 / 1
| 1
reach
"Dual Variation in SCN5A and CACNB2b Underlies the Development of Cardiac Conduction Disease without Brugada Syndrome."
SCN5A affects CXADR
| 1
SCN5A activates CXADR. 1 / 1
| 1
reach
"[XREF_BIBR - XREF_BIBR] Similar scenarios could also be seen in cases of acquired long QT syndrome and ischemic cardiomyopathy, in which rare variants (KCNH2, KCNE1, KCNE2, KCNQ2, SCN5A, and RyR2 in drug induced long QT syndrome and CASQ2, RAB3GAP1, ZNF365, CXADR, GPC5, GPD1L, NOS1AP, and SCN5A in ischemic cardiomyopathy) were associated with higher risk of malignant arrhythmia and SCD."
SCN5A affects CKI1
| 1
SCN5A activates CKI1. 1 / 1
| 1
sparser
"Up-regulation of Hb1 or Hb2 activated CKI1 and AHK3 , genes encoding cytokinin receptors and altered expression of cytokinin response regulators (ARRs)."
SCN5A affects CDK2
1 |
1 |
biogrid
No evidence text available
SCN5A affects CD4SP
| 1
SCN5A activates CD4SP. 1 / 1
| 1
reach
"Scn5a shRNA knockdown impairs CD4SP positive selection."
SCN5A affects CD37 antigen
| 1
SCN5A increases the amount of CD37 antigen. 1 / 1
| 1
reach
"We herein report a comparison of the radiolabels 177Lu and 125I bound to the monoclonal antibody HH1 that targets the CD37 antigen expressed on non Hodgkin B-cell lymphomas."
SCN5A affects CD37
| 1
| 1
reach
"Even though Ramos cells had a higher expression of CD20 than CD37, the absorbed doses to tumor for 177 Lu-HH1 and 177 Lu-rituximab were similar, which might be related to the higher internalization of the CD37 and HH1 complex than of the CD20-rituximab, as observed in vitro."
SCN5A affects CBL
1 |
1 |
hprd
No evidence text available
SCN5A affects CASQ2
| 1
SCN5A activates CASQ2. 1 / 1
| 1
reach
"[XREF_BIBR - XREF_BIBR] Similar scenarios could also be seen in cases of acquired long QT syndrome and ischemic cardiomyopathy, in which rare variants (KCNH2, KCNE1, KCNE2, KCNQ2, SCN5A, and RyR2 in drug induced long QT syndrome and CASQ2, RAB3GAP1, ZNF365, CXADR, GPC5, GPD1L, NOS1AP, and SCN5A in ischemic cardiomyopathy) were associated with higher risk of malignant arrhythmia and SCD."
SCN5A affects BrS-associated variants
| 1
SCN5A activates BrS-associated variants. 1 / 1
| 1
reach
"In fact, it has been estimated that 10% of the previously published SCN5A mediated BrS associated variants (BrS1) and long QT syndrome associated SCN5A variants (LQT3) are wrong."
SCN5A affects BCD
| 1
SCN5A inhibits BCD. 1 / 1
| 1
reach
"Such a difference arises because the BCD ' at any given pacing rate was reduced both by the Scn5a +/- genotype and by the further addition of flecainide in the RV epicardium (XREF_FIG)."
SCN5A affects BCAM
| 1
| 1
sparser
"A series of pre-clinical studies have shown that 177 Lu-HH1 successfully binds to both lymphoma cell lines and biopsies from NHL patients, indicating that targeting of the CD37 antigen with HH1 is clinically relevant [ xref ]."
SCN5A affects Arg-Val
| 1
SCN5A increases the amount of Arg-Val. 1 / 1
| 1
reach
"Our study supports this hypothesis in showing higher mRNA and protein expression of KChIP2 in the RV than LV of WT and Scn5a +/- hearts, which could act to increase RV expression of K v 4.3."
SCN5A affects Action potential
1 |
SCN5A activates Action potential. 1 / 1
1 |
signor
"The expression of voltage-gated sodium channels (NaVs) is a key feature for initiation and conduction of action potentials in excitable tissues and cells such as cardiac and skeletal muscle and neurons."
SCN5A affects Actin
| 1
| 1
sparser
"We also examined G-actin-HH1 interaction by immunoprecitation and immunoblotting."
SCN5A affects ATP5F1A
| 1
| 1
sparser
"Mutations in SCN5A, which encodes the pore-forming cardiac sodium channel alpha subunit, are associated with familial arrhythmia syndromes based on conduction slowing."
SCN5A affects ASGR1
| 1
SCN5A activates ASGR1. 1 / 1
| 1
reach
"A complex of beta-catenin and TCF4 inhibits cardiac Na + channel activity by reducing Na V 1.5 expression through suppressing SCN5A promoter activity in HL-1 cardiomyocytes."
SCN5A affects ALB
1 |
1 |
biogrid
No evidence text available
SCN5A affects AHK3
| 1
SCN5A activates AHK3. 1 / 1
| 1
sparser
"Up-regulation of Hb1 or Hb2 activated CKI1 and AHK3 , genes encoding cytokinin receptors and altered expression of cytokinin response regulators (ARRs)."
SCN5A affects AGTGGAATTCCACTTTTTTT
| 1
SCN5A activates AGTGGAATTCCACTTTTTTT. 1 / 1
| 1
reach
"The shRNA structure was removed by restriction with EcoRI (underlined) and after religation to result in pENTR-hH1 with the following recombinant hH1 driven transcript expression cassette : AGTGGAATTCCACTTTTTTT."
SCN5A affects AFAP1
| 1
| 1
sparser
"Formation of 3D Acini Structures MCF-10A and HB2 cells were infected to express mCherry (with pQC-mCherry retroviral vector), and formation of 3D acini structures was performed as previously described [56,57]."
SCN5A affects AERP
| 1
SCN5A activates AERP. 1 / 1
| 1
reach
"Aged Scn5a (+/-) mice exhibited normal EGD, EGD ratios and APD compared to aged WT and young Scn5a (+/-), and increased AERP and smaller APD and AERP ratios compared with young Scn5a (+/-)."
SCN5A affects ADRB
| 1
| 1
sparser
"In the genetic forms of LQT that do not respond to β-adrenergic receptor blockers, such as LQT3, drugs that target the sodium channel prevent cardiac arrhythmias ( xref )."
SBE1 affects SCN5A
| 1
| 1
sparser
"Apparent amylose content, alkali digestion value, setback viscosity, and pasting temperature were associated with SBE1 , SSS1 , and SSS2A . Peak viscosity was associated with SBE1 , SBE3 , GBSS1 , and SSS1 ."
S422DSGK1 affects SCN5A
| 1
S422DSGK1 activates SCN5A. 1 / 1
| 1
reach
"SCN5A currents were activated by coexpression of either wild-type SGK1 or SGK3 or the constitutively active S422DSGK1."
| 1
Reactive Oxygen Species increases the amount of SCN5A. 1 / 1
| 1
reach
"85 ROS can downregulate Na v 1.5 at the transcriptional level by reducing SCN5A expression, XREF_BIBR, XREF_BIBR and at the post-translational level by affecting channel phosphorylation and conductance."
RGS3 affects SCN5A
1 |
1 |
hprd
No evidence text available
RGS2 affects SCN5A
1 |
1 |
hprd
No evidence text available
| 1
sparser
"SCN5A and SCN10A cardiac sodium channel related genes are associated with AF."
PROTEIN affects SCN5A
| 1
SCN5A binds PROTEIN. 1 / 1
| 1
trips
"The major cardiac voltage-gated sodium channel Nav1.5 associates with proteins that regulate its biosynthesis, localization, activity and degradation."
PKP2 affects SCN5A
| 1
| 1
sparser
"In a subsequent study on cultured cardiomyocytes (Sato et al., xref ), it was shown that PKP2 associates with the SCN5A encoded sodium channel protein Na V 1.5 and that knockdown of PKP2 expression alters the properties of the sodium current."
PITX2 affects SCN5A, and ion channel
| 1
sparser
"The rs2200733 has been associated with expression of PITX2 , which is a transcription factor, and the expression level of PITX2 has been associated with structural changes as well as expression of ion channel genes such as SCN5A [ xref ]."
PGR affects SCN5A, and TBX5
| 1
SCN5A binds TBX5 and PGR. 1 / 1
| 1
sparser
"In meta-analyses of P-wave duration, we identified 6 significant ( P <5×10 - 8 ) novel loci and replicated a prior association with S CN10A. We identified 3 loci at SCN5A , TBX5 , and CAV1/CAV2 that were jointly associated with the PR interval, PR segment, and P-wave duration."
PATJ affects SCN5A
1 |
1 |
hprd
No evidence text available
NRPS3 affects SCN5A
| 1
| 1
sparser
"In detail, we found that Asp83B can modify its conformation to stably form a previously uncharacterized H-bond Hb2 interaction with the right-hand side (RHS) of Cpd1 and Cpd2, while Asp83D locks the NBTIs linker through the crucial H-bond Hb1."
NOS1 affects SCN5A, and ion channel
| 1
| 1
sparser
"Thus, the association of nNOS complex-related proteins with both SCN5A and other cardiac ion channels deserves further study."
NADH affects SCN5A
| 1
NADH inhibits SCN5A. 1 / 1
| 1
reach
"NADH (100 mumol/L) alone reduced I Na to 0.54 +/- 0.04 of SCN5A group (P < 0.01) XREF_BIBR, while in the presence of FGIN-1-27 (500 mumol/L), the reduction of I Na by NADH was 0.51 +/- 0.04 (P < 0.01)."
NAD(+) affects SCN5A
| 1
NAD(+) inhibits SCN5A. 1 / 1
| 1
reach
"NAD + supplementation acts via a membrane surface receptor to reverse the inducible VT in SCN5A +/- mice 9."
| 1
N-carbamoylsarcosine increases the amount of SCN5A. 1 / 1
| 1
reach
"In contrast, Scn1b null mouse CMs have increased expression of Scn3a and Scn5a, along with increased TTX-S and TTX-R I Na."
MiR-192-5p affects SCN5A
| 1
MiR-192-5p decreases the amount of SCN5A. 1 / 1
| 1
reach
"MiR-192-5p negatively regulates expression of SCN5A at both mRNA and protein levels."
MiNP affects SCN5A
| 1
MiNP activates SCN5A. 1 / 1
| 1
reach
"Samples HH1 and HH2 were treated with MEHP and MiNP at 0.1, 1, 3, and 10 muM."
MINK1 affects SCN5A
| 1
MINK1 activates SCN5A. 1 / 1
| 1
reach
"These studies indicate that, as in KVLQT1, mutations in minK can cause both autosomal dominant (Romano-Ward syndrome) and autosomal-recessive (JLN) LQT.Identification of SCN5A, HERG, KVLQT1 and minK as LQT genes has led to the identification of three critical electrical currents involved in the cardiac action potential."
MED36A affects SCN5A
| 1
MED36A inhibits SCN5A. 1 / 1
| 1
reach
"We used Flp and FRT mediated targeting to delete residues 1510-1512 (QKP) in the Scn5a gene (see supplementary material online, methods and Fig."
Lqh II affects SCN5A
| 1
Lqh II inhibits SCN5A. 1 / 1
| 1
reach
"Although under control conditions hH1 channels inactivate rapidly and completely, Lqh II and Lqh III at that low concentration strongly slowed down fast inactivation of hH1 channels."
Long QT Syndrome 811 Orita affects SCN5A
| 1
Mutated SCN5A binds Long QT Syndrome 811 Orita. 1 / 1
| 1
reach
"SCN5A Mutations Associated with Long QT Syndrome 811 Orita, M., Iwahana, H., Kanazawa, H., and Sekiya, T. (1989)."
Long QT Syndrome 807 Table 2 affects SCN5A
| 1
Mutated SCN5A binds Long QT Syndrome 807 Table 2. 1 / 1
| 1
reach
"SCN5A Mutations Associated with Long QT Syndrome 807 Table 2."
Leu-Thr affects SCN5A
| 1
Leu-Thr activates SCN5A. 1 / 1
| 1
reach
"There were 116 and 271 DEG in HH1 treated with HT and LT, and 194, 372, 148 and 157 DEG in HH1 inoculated with JxoI, Pxo99, Rs105 and Xv5, respectively (XREF_TABLE)."
LUC7L3complex affects SCN5A
| 1
LUC7L3complex activates SCN5A. 1 / 1
| 1
reach
"RBM25 and LUC7L3complex mediates abnormal SCN5A mRNA regulation."
LQTS type 3 affects SCN5A
| 1
LQTS type 3 activates SCN5A. 1 / 1
| 1
reach
"LQTS type 3, caused by gain-of-function mutations in the sodium ion channel encoding gene SCN5A, was also recapitulated in iPSC-CMs by decreased voltage dependent inactivation of sodium channels."
LQT3 affects SCN5A
| 1
SCN5A binds LQT3. 1 / 1
| 1
reach
"To date, mutational analyses have revealed about 103 distinct mutations in SCN5A, of which at least more than 30 mutations are associated with LQT3, whereas the rest of the mutations are affiliated with the remaining sodium channel disorders."
LF3 affects SCN5A
| 1
LF3 activates SCN5A. 1 / 1
| 1
reach
"Luciferase reporter assays performed in HEK 293T cells and HL-1 revealed that LF3 increased the SCN5A promoter activity in HL-1 cells and prevented beta-catenin suppressive effect on SCN5A promoter activity in HEK 293 cells."
LDLR affects LPL, and SCN5A
| 1
SCN5A binds LDLR and LPL. 1 / 1
| 1
sparser
"These variations in the lipoprotein concentrations were associated with inverse changes in the hepatic protein levels of the LDL receptor (+118%) and HB2 (-46%)."
LDB3 affects SCN5A, and Sodium_channels
| 1
sparser
"Previous functional analyses in HEK293 and neonatal rat cardiomyocytes demonstrated that ZASP interacts with the SCN5A -coded sodium channel Na v 1.5, and affects the channel voltage-dependent activation and inactivation, leading to loss of function of Na v 1.5, consistent with the conduction defects seen in the variant harboring patients [ xref ]."
L1821fs/10 mutation affects SCN5A
| 1
L1821fs/10 mutation inhibits SCN5A. 1 / 1
| 1
reach
"The L1821fs/10 mutation causes the most severe disruption of SCN5A structure for a naturally occurring mutation that still produces current."
Kir2.1 affects SCN5A
| 1
Modified Kir2.1 increases the amount of SCN5A. 1 / 1
| 1
reach
"XREF_BIBR showed that changes in functional expression of Kir2.1 modulates expression of Scn5a (Na V 1.5) and vice versa to alter cardiac excitability."
KCNE5 affects PSMD4, and SCN5A
| 1
| 1
sparser
"In addition, variations in the KCNE5 and SCN5A genes have been associated with AF, the latter encoding the cardiac sodium channel Na v 1.5."
KCNE1 affects SCN5A, and TCAP
| 1
SCN5A binds TCAP and KCNE1. 1 / 1
| 1
sparser
"The telethonin-minK or telethonin-SCN5A interaction may thus have little physiological relevance in the heart, at least in the mouse model ( xref )."
| 1
sparser
"To our knowledge, only one study has utilized sequencing to examine rare variation in unselected SCD cases from adult populations. xref , xref The entire coding sequence and splice junctions of five ion channel genes associated with IADS, SCN5A, KCNE1, KCNE2, KCNQ1 and KCNH2 , were directly sequenced in 113 cases of SCD. xref No unique or rare coding sequence variants were identified in any of the ion channel genes in 53 men. xref In 60 women with SCD, 6 rare missense variants (10%) were identified in the cardiac sodium channel gene (SCN5A) . xref The overall frequency of these rare variants in SCN5A was significantly higher in the SCD cases compared to 733 controls from the same population (1.6%; P=0.001), and subtle alterations in ion channel function were observed for 4 of the 5 variants."
KCND3 affects SCN1Bb, and SCN5A
| 1
SCN5A binds KCND3 and SCN1Bb. 1 / 1
| 1
sparser
"These results provide evidence in support of an interaction of subsidiary SCN1Bb subunits (both WT and rare variant) with SCN5A and KCND3 subunits in the transfected cells."
KCNA5 affects SCN5A, and ion channel
| 1
sparser
"The XIRP proteins interact with cardiac ion channel proteins Nav1.5 and Kv1.5 within intercalated 8 ."
| DOI
KCN affects SCN5A
| 1
| 1
sparser
"We have also demonstrated that mutations in HERG, a SCN5A Mutations Associated with Long QT Syndrome 8O9 putative cardiac potassium channel gene, cause the chro- mosome 7-1inked form of LQT (Curran et al., 1995)."
ISO affects SCN5A
| 1
ISO decreases the amount of SCN5A. 1 / 1
| 1
reach
"Reverse transcribed-polymerase chain reactions (RT-PCR) showed that ISO increased expression of SCN5A and alpha (1c) (alpha-subunit of the cardiac sodium and L-type calcium channel, respectively)."
INA affects SCN5A
| 1
| 1
sparser
"Compared with Cav3-WT, Cav3-F97C produced significantly larger peak INa amplitudes, and showed 3.3-fold increase in the late INa associated with increased S-nitrosylation of SCN5A. L-NMMA reversed both the Cav3-F97C induced increase in late and peak INa and decreased S-nitrosylation of SCN5A. Overexpression of Cav3-F97C in adult rat cardiomyocytes caused a significant increase in late INa compared to Cav3-WT, and prolonged the action potential duration (APD90) in a nNOS-dependent manner."
IL10 affects SCN5A
1 |
Transcriptionally active IL10 decreases the amount of SCN5A. 1 / 1
1 |
signor
"Interleukin-10 down-regulates voltage gated sodium channels in rat dorsal root ganglion neurons. Consistent with the electrophysiological results, real-time PCR and western blot revealed that IL-10 (200 pg/ml) down-regulated VGSCs in both mRNA and protein levels and reversed the up-regulation of VGSCs by TNF-α."
IGF1R affects SCN5A
| 1
IGF1R phosphorylates SCN5A. 1 / 1
| 1
sparser
"MK-0646 decreased the IGF1-stimulated IGF1R phosphorylation in wild-type BRCA1-expressing MCF7 and HB2, but not in mutant BRCA1-expressing HCC1937, cells (compare lanes 2 versus 3)."
ID1 affects SCN5A
| 1
ID1 activates SCN5A. 1 / 1
| 1
reach
"To test whether or not the beta 1 ID is sufficient to modulate hH1 currents, two chimeras were constructed that contained the beta 1 ID, the beta 2 MA, and either the beta 1 or the beta 2 ED (beta 121 and beta 221; XREF_FIG A)."
HLA-B affects SCN5A
| 1
| 1
sparser
"She later tested positive for class I deleterious mutation of SCN5A Thr1709Met ( xref ), which has been associated with prior cases of BrS. (; accessed on 11/4/2015)."
HIF1A affects SCN5A
| 1
HIF1A activates SCN5A. 1 / 1
| 1
reach
"28 It is possible that HIF-1alpha is an intermediate mediator of RBM25 and LUC7L3 dependent splicing regulation of SCN5A."
HB1 affects MTRNR2L1, and SCN5A
| 1
SCN5A binds MTRNR2L1 and HB1. 1 / 1
| 1
sparser
"HB1, HB2, and HB3 are formed by HN1, HN2, and HN3 with one F – anion with the atomic distance of 1.58, 1.40, and 1.58 Å, respectively, in the gas phase."
G_i affects KCNH2, and SCN5A
| 1
G_i binds SCN5A and KCNH2. 1 / 1
| 1
sparser
"The aim of this study was to determine if the cardiac channelopathy-associated mutations in SCN5A or KCNH2 are associated with GI symptom complexes."
GS26575 affects SCN5A
| 1
GS26575 activates SCN5A. 1 / 1
| 1
reach
"Bm K M1 also induces a significant hyperpolarizing shift of the steady-state inactivation of hH1."
GJA1 affects RAS, SCN5A, and TPS-sab
| 1
| 1
sparser
"It appears that cardiac-specific RAS dysregulation causing changes in SCN5A and gap junction protein levels may be associated with non-familial SSS."
GATA5 affects SCN5A
| 1
GATA5 increases the amount of SCN5A. 1 / 1
| 1
reach
"Our studies suggest that GATA5 but especially GATA4 are main contributors to SCN5A gene expression, thus providing a new paradigm of SCN5A expression regulation that may shed new light into the understanding of cardiac disease."
GAN affects SCN5A
1 |
1 |
biogrid
No evidence text available
G affects SCN5A
| 1
G leads to the dephosphorylation of SCN5A. 1 / 1
| 1
reach
"This effect is not substrate selective, as G-actin inhibited phosphorylation of both HH1 and tau proteins."
Foxos deletion affects SCN5A
| 1
Foxos deletion decreases the amount of SCN5A. 1 / 1
| 1
reach
"Silico promoter analysis on a list of 354 of the most differentially expressed genes in the thymocyte lineage has revealed putative direct targets that are transcriptionally regulated by Foxo proteins in thymocytes, and that SCN5a transcription is upregulated by Foxos deletion XREF_BIBR."
Foxos affects SCN5A
| 1
Foxos increases the amount of SCN5A. 1 / 1
| 1
reach
"These findings suggest that transcription of SCN5A may be directly regulated by Foxos in cardiomyocytes."
FRT affects SCN5A
| 1
FRT inhibits SCN5A. 1 / 1
| 1
reach
"We used Flp and FRT mediated targeting to delete residues 1510-1512 (QKP) in the Scn5a gene (see supplementary material online, methods and Fig."
FOXO affects SCN5A
| 1
FOXO inhibits SCN5A. 1 / 1
| 1
reach
"XREF_BIBR A promoter analysis in Cre induced downregulation of FoxO proteins showed that decrease in FoxO proteins can increase SCN5A transcript in a thymocyte lineage."
FGFR2 affects RPS6KA3, and SCN5A
| 1
| 1
sparser
"Having demonstrated that FGFR2 and RSK2 formed a transient and indirect complex in HB2 cells, we went on to establish whether their association was dependent on RSK2 and/or FGFR2 activity (Fig. xref d)."
ESR1 affects SCN5A
1 |
Transcriptionally active ESR1 decreases the amount of SCN5A. 1 / 1
1 |
signor
"The effects of β-oestradiol (E2), the biologically active form of oestrogen, are classically mediated by two types of oestrogen receptor (ER): ERα and ERβ. E2 has both non-genomic and genomic effects upon VGSC expression/activity; and (ii) transcriptionally, E2 (via ERα) downregulates functional VGSC (nNav1.5) expression in BCa cells."
EF-hand affects SCN5A
| 1
| 1
sparser
"Wingo et al. ( xref ) proposed a novel mechanism for modulation of Na channel function where Ca ions bind directly to hH1 via an EF-hand motif in the C-terminal domain."
Different beta 1 Subunit Regions affects SCN5A
| 1
Different beta 1 Subunit Regions activates SCN5A. 1 / 1
| 1
reach
"HH1 and IIA Channels Are Modulated by Different beta 1 Subunit Regions."
DMD affects SCN5A
| 1
| 1
reach
"Cav3, SNTA1, and SCN5A also bind to dystrophin, the protein that causes Duchenne and Becker muscular dystrophy with DCM or LVNC, as does SAP97."
DLG4 affects SCN5A
1 |
1 |
hprd
No evidence text available
DLG3 affects SCN5A
1 |
1 |
hprd
No evidence text available
DLG2 affects SCN5A
1 |
1 |
hprd
No evidence text available
DLG1 affects SCN5A
1 |
1 |
hprd
No evidence text available
DCM affects PSMD4, SCN5A, TPS-sab, and bop
| 1
SCN5A binds PSMD4, TPS-sab, bop, and DCM. 1 / 1
| 1
sparser
"Since then, mutations in all domains of SCN5A have been associated with LQTS, BrS [1], PFHB [ xref ], SSS [ xref ], DCM [ xref ] and l-AF [ xref ]."
DCM affects LMNA, and SCN5A
| 1
SCN5A binds LMNA and DCM. 1 / 1
| 1
sparser
"For example, mutations in LMNA and SCN5A have been associated with a cardiac syndrome of DCM, impaired automaticity and conduction, and atrial fibrillation ( xref – xref )."
DCM affects FLNC, and SCN5A
| 1
SCN5A binds FLNC and DCM. 1 / 1
| 1
sparser
"Mutations in the DCM genes, SCN5A and FLNC , are also associated with higher rates of arrhythmias. xref , xref These specific arrhythmia associations with pathogenic mutations in LMNA , RBM20 , SCN5A , or FLNC are of urgent importance, and genetic evaluation should be standard of care for DCM patients to better delineate this risk."
CTCF affects SCN5A, and SUZ12
| 1
SCN5A binds CTCF and SUZ12. 1 / 1
| 1
sparser
"These data show that the CTCF-Sss1 protein, which lacks the CTCF NT domain, was unable to bind SUZ12."
CRISPR affects SCN5A
| 1
CRISPR increases the amount of SCN5A. 1 / 1
| 1
reach
"CRISPR and Cas9 mediated correction of the mutation re-establishes sodium current density and SCN5A expression."
CREBZF affects SCN5A, SUZ12, and egfp
| 1
| 1
sparser
"As expected, SUZ12 was detected in the reaction with full-length CTCF ( xref , top panel, lane 2), but neither ZF-Sss1 nor ZF-EGFP interacted with SUZ12 ( xref , top panel, lanes 3 and 4)."
CD37 affects SCN5A
| 1
| 1
reach
"Even though Ramos cells had a higher expression of CD20 than CD37, the absorbed doses to tumor for 177 Lu-HH1 and 177 Lu-rituximab were similar, which might be related to the higher internalization of the CD37 and HH1 complex than of the CD20-rituximab, as observed in vitro."
CBL affects SCN5A
1 |
1 |
hprd
No evidence text available
CAV3 affects KCNE1, KCNE2, KCNJ2, KCNQ1, and SCN5A
| 1
| 1
sparser
"However, pathogenic variants associated with KCNQ1 , SCN5A , KCNE1 , KCNE2 , KCNJ2 , and CAV3 were not observed."
CACNA1C affects CAV3, and SCN5A
| 1
| 1
sparser
"Mutations of SCN5A, CACNA1C and CAV3 are associated with ventricular tachycardia, long-QT syndromes (LQT3,8,9), and sudden cardiac death while mutations of HCN4 cause sick sinus syndrome type 2 xref ."
BKM120 affects SCN5A
| 1
BKM120 activates SCN5A. 1 / 1
| 1
reach
"Chronic exposure (10-100 nM; 5-48 hours) to PI3K- alpha -specific subunit inhibitors BYL710 (alpelisib) and A66 and a pan-PI3K inhibitor (BKM120) increased I NaL in SCN5A -transfected CHO cells and mouse cardiomyocytes."
BCAM affects SCN5A
| 1
| 1
sparser
"A series of pre-clinical studies have shown that 177 Lu-HH1 successfully binds to both lymphoma cell lines and biopsies from NHL patients, indicating that targeting of the CD37 antigen with HH1 is clinically relevant [ xref ]."
BAG3 affects EAF2, RYR2, and SCN5A
| 1
RYR2 binds SCN5A, EAF2, and BAG3. 1 / 1
| 1
sparser
"Among the 6 genes, BAG3, RYR2 , and SCN5A were associated with only AD traits, while DSP , PKP2 , and TNNI3 were associated with both AD and AR traits ( xref , xref )."
Actin affects SCN5A
| 1
| 1
sparser
"We also examined G-actin-HH1 interaction by immunoprecitation and immunoblotting."
ATPase activity affects SCN5A, and SNTA1
| 1
sparser
"SNTA1 associates with the cardiac sodium channel SCN5A and the plasma membrane Ca 2+ -ATPase PMCA4B (also known as ATP2B4), and mutations in SNTA1 are associated with long QT syndrome 12 ( xref )."
ATP5F1A affects SCN5A
| 1
| 1
sparser
"Mutations in SCN5A, which encodes the pore-forming cardiac sodium channel alpha subunit, are associated with familial arrhythmia syndromes based on conduction slowing."
ATP affects SCN5A
| 1
ATP inhibits SCN5A. 1 / 1
| 1
reach
"The K (ATP) channel-opener nicorandil (20muM) significantly reduced arrhythmic incidence in Langendorff perfused Scn5a +/Delta hearts during programmed electrical stimulation; wild-types (WTs) showed a total absence of arrhythmogenicity."
AS affects RYR2, and SCN5A
| 1
RYR2 binds SCN5A and AS. 1 / 1
| 1
sparser
"Of those 30 genes, 2 have been associated with AS— RYR2 and SCN5A . Our patient’s testing was negative for RYR2 and SCN5A but did reveal mutation in CAV3 ."
APP affects SCN5A
1 |
Transcriptionally active APP decreases the amount of SCN5A. 1 / 1
1 |
biopax:ctd
No evidence text available
ANK3 affects SCN5A
| 1
| 1
sparser
"A mutation in SCN5A (E1053K) discovered in a patient with BrS disrupts association of SCN5A with ankyrin-G, resulting in decreased I Na [ xref ]."
ALB affects SCN5A
1 |
1 |
biogrid
No evidence text available
| 1
sparser
"The Romano-Ward syndrome, which occurs commonly in an autosomal dominant fashion, encompasses heterozygous mutations associated with KCNQ1 (LQT1), KCNH2 (LQT2), SCN5A (LQT3), KCNE1 (LQT5), KCNE2 (LQT6), CAV3 (LQT9), SCN4B (LQT10), AKAP9 (LQT11), SNTA1 (LQT12) and KCNJ5 (LQT13)."
AFAP1 affects SCN5A
| 1
| 1
sparser
"Formation of 3D Acini Structures MCF-10A and HB2 cells were infected to express mCherry (with pQC-mCherry retroviral vector), and formation of 3D acini structures was performed as previously described [56,57]."
ADRB affects SCN5A
| 1
| 1
sparser
"In the genetic forms of LQT that do not respond to β-adrenergic receptor blockers, such as LQT3, drugs that target the sodium channel prevent cardiac arrhythmias ( xref )."
1 |
ACTC1 affects MYH7, SCN5A, TAZ, TNNT2, TPM1, and YWHAE
| 1
| 1
sparser
"Previous reports show that defects in TAZ, SCN5A, TPM1, YWHAE, MYH7, ACTC1 and TNNT2 are associated with LVNC."
A390V-SNTA1 affects SCN5A
| 1
A390V-SNTA1 activates SCN5A. 1 / 1
| 1
reach
"In contrast, A390V-SNTA1 selectively disrupted association of PMCA4b with this complex and increased direct nitrosylation of SCN5A."
| 1
reach
"Chronic exposure (10-100 nM; 5-48 hours) to PI3K- alpha -specific subunit inhibitors BYL710 (alpelisib) and A66 and a pan-PI3K inhibitor (BKM120) increased I NaL in SCN5A -transfected CHO cells and mouse cardiomyocytes."
| 1
reach
"A nonsense SCN5A mutation associated with Brugada type ECG and intraventricular conduction defects."