This page allows you to curate the loaded statements. For more information please see the manual.

Statements

databases
phosphosite cbn pc11 biopax bel_lc signor biogrid lincs_drug tas hprd trrust ctd virhostnet phosphoelm drugbank omnipath | geneways tees isi trips rlimsp medscan sparser eidos reach
reading

| 9 61
reach
"In addition, suppression of Eag1 expression in several cancer cell lines causes a significant reduction of cell proliferation [XREF_BIBR, XREF_BIBR]."
reach
"The results showed that knockdown of Eag1 significantly suppressed osteosarcoma cell proliferation and osteosarcoma xenografts growth."
reach
"On the contrary, Kv10.1 is overexpressed in a variety of cell lines derived from human malignancies and in different cancers including head and neck, gastric, colon, hepatocellular pancreatic, renal or prostate carcinoma [XREF_BIBR - XREF_BIBR, XREF_BIBR, XREF_BIBR, XREF_BIBR] within which Kv10.1 enhances the proliferation of the cells and is required for the maintenance of growth."
reach
"In these cell lines, eag1 enhances the proliferation of the cells XREF_BIBR, and is required for the maintenance of growth."
reach
"Eag1 Blockage Reduces the Proliferation of Liposarcoma Cells."
reach
"XREF_BIBR The inhibition of Eag1 expression using antisense oligonucleotides or siRNA, or pharmacological inhibition with imipramine, astemizole or quinidine can reduce cell proliferation in cancer cell lines."
reach
"Moreover, inhibition of EAG1 channel activity with an antibody or siRNA reduces DNA synthesis and proliferation of tumor cells."
reach
"In addition, Eag channels have been suggested to promote the proliferation of cancer cells."
reach
"These data suggested that Eag1 may promote OS proliferation and migration, at least in part, through positive regulation of STAT3-VEGF pathway."
reach
"The precise mechanism how K V 10.1 promotes proliferation of cancer cells is still under debate, although it is known that it includes both permeation dependent and -independent components."
reach
"It has been proposed recently that perinuclear localization of Eag1 could lead to the activation of MAPK pathway, resulting in increased cell proliferation [XREF_BIBR]."
reach
"Collectively, these results suggest that Eag promotes the proliferation of MG-63 cells in vitro."
reach
"Silencing of Eag1 Gene Inhibits Osteosarcoma Proliferation and Migration by Targeting STAT3-VEGF Pathway."
reach
"Eag1 promotes oncogenesis, proliferation and tumor progression; and therefore it is used as a marker and therapeutic target for several types of cancers XREF_BIBR, XREF_BIBR."
reach
"Eag1 Silencing Reduces the Proliferation of Osteosarcoma Cells."
reach
"It has been later shown that this EAG1 channel selective increase in cell proliferation does not require K + conduction (Downie et al., 2008)."
reach
"Normally, Eag1 is expressed almost exclusively in tissue of neural origin, but its ectopic expression leads to uncontrolled proliferation, while inhibition of Eag1 expression produces a concomitant reduction in proliferation."
reach
"Considering the latter and that calcitriol displays antineoplastic effects, while the potassium channel Ether-a-go-go (Eag1) promotes proliferation and tumor progression [13], we hypothesized that Eag1 might be a potential target for calcitriol."
reach
"The inhibition of Eag-1 channel activity suppresses the proliferation of breast cancer cells and accumulates cells in G1 phase of the cell cycle [8,9]."
reach
"However, this does not explain the observation that the proliferation of cell lines, derived from all mentioned tumor types, is reduced by inhibition of the expression or function of K V 10.1 XREF_BIBR."
reach
"XREF_BIBR Moreover, siRNA targeting of Eag XREF_BIBR, XREF_BIBR or non specific blockers XREF_BIBR have been shown to suppress the proliferation of tumor cells."
reach
"Moreover, proliferation induced by Eag1 is unaffected by changes in extracellular Ca 2+, suggesting that increased Ca 2+ influx is not an essential downstream component of Eag1 induced signaling."
reach
"Two potent blockers of K V 10.1, astemizole (40, XREF_FIG) and imipramine (41) have been shown to decrease tumor cell proliferation in vitro, and, in the case of astemizole, also in vivo XREF_BIBR, XREF_BIBR - XREF_BIBR."
reach
"The suppression of Eag1 expression caused a significant reduction of cancer cell proliferation XREF_BIBR - XREF_BIBR."
reach
"We found that EAg pulsed dendritic cells (DCs) induced proliferation of LFA-1-deficient (CD11a -/-) CD4 + T-cells that was very similar to that induced using WT T-cells suggesting that LFA-1 is not required for activation and proliferation of T-cells in vitro."
reach
"In these cell lines, Eag1 enhances the proliferation of the cells, and is required for the maintenance of growth."
reach
"As a functional correlate, specific hEag1 blockade inhibited the proliferation and migration of several AML cell lines and primary cultured AML cells in vitro."
reach
"Finally, siRNA mediated knockdown of Eag1 expression reduces proliferation, and the inhibition of channel function reduces tumor progression both in vitro and in vivo."
reach
"Based on the findings in previous studies that potassium voltage gated channel subfamily H member 1 (KCNH1) was overexpressed in osteosarcoma and promoted the proliferation and invasion of osteosarcoma [XREF_BIBR - XREF_BIBR] and on our profile of the miRanda, PITA, RNAhybrid databases to explore the corresponding circRNAs of KCNH1, we speculated that hsa-circ-0016347 may be a potential regulator of osteosarcoma progression."
reach
"Our data help reveal possible mechanisms by which Eag1 promotes cell proliferation (XREF_FIG)."
reach
"So Eag1 blockers could reduce proliferation not only by inhibiting permeation, but also by trapping Eag1 in a particular conformation [XREF_BIBR]."
reach
"To analyze how Eag1 modulates OS cell proliferation and cell cycle progression, it is important to note that Eag1 contributes to tumor progression independently of its primary function as an ion channel."
reach
"Our data indicated that Eag1 promotes osteosarcoma proliferation and migration, at least in part, by targeting STAT3-VEGF pathway."
reach
"Ectopic expression of miR-296-3p reduced EAG1 expression and suppressed cell proliferation drug resistance, and the luciferase activity of an EAG1 3 '-untranslated region based reporter construct in U251AR cells, whereas EAG1 over-expression rescued the suppressive effect of miR-296-3p in U251AR cells."
reach
"Conclusions : Eag1 may promote osteosarcoma cell proliferation and invasion by targeting STAT3-VEGF pathway and may be a potential therapeutic target for osteosarcoma."
reach
"Interestingly, a recent study reported that the inhibition of Eag1 inhibited the proliferation of human bone marrow derived mesenchymal stem cells, accompanied by reduced levels of cyclin D1, cyclin E, p-ERK1/2, and p-Akt [XREF_BIBR]."
reach
"In fact, selective pharmacological blockage of the HERG channel in several primary leukemic cells significantly reduced cell proliferation (Pillozzi et al., 2002; Crociani et al., 2003; Smith et al., 2002), and other studies showed that inhibition of eag1 expression with antisense oligonucleotides was sufficient to decrease the proliferation of some cancer cell lines (Pardo et al., 1999)."
reach
"Inhibition of Eag1 expression in tumour cell lines reduced cell proliferation."
reach
"XREF_BIBR - XREF_BIBR In addition, Eag1 enhances tumor cell proliferation, is involved in tumor progression and metastasis, and is associated with poor prognosis."
reach
"Silencing hEAG1 by RNA interference or hEAG1 channel inhibition by monoclonal antibody has been found to remarkably suppress cell proliferation and tumor progression [8,42]."
reach
"Further, pharmacologic blockade of EAG1 channel activity XREF_BIBR, XREF_BIBR, XREF_BIBR and inhibition of channel expression by RNAi interference XREF_BIBR decreased cell proliferation in tumor tissues."
reach
"It has been demonstrated that expression of a mutant form of Eag1, that can not conduct current, promotes proliferation of NIH3T3 fibroblasts and C2C12 myoblasts cells."
reach
"Increased expression of EAG1 has been linked to certain cancers and tumor cell lines, and EAG1 inhibition by blockers, antibodies, and siRNA decreases the proliferation of tumor cell lines."
reach
"Collectively, these results suggest that Eag1 promotes the proliferation of liposarcoma cells in vitro."
reach
"Eag has also been shown to activate p38 MAPK and stimulate proliferation of several cell lines in a voltage dependent manner that does not require ion flux."
reach
"RNA interference inhibition of Eag1 and Best1 reduced proliferation of T (84)-fast cells, whereas overexpression of Best1 turned T (84)-slow into fast growing cells."
reach
"We observed that hEag1 inhibition reduced the proliferation of several AML cell lines."
reach
"Collectively, these results suggest that Eag1 promotes the proliferation of OS cells in vitro."
reach
"In agreement with the proliferative potential conferred by K V 10.1 (hEAG1) to different cell types [XREF_BIBR], block of hEAG1 tended to inhibit cell proliferation in both cell types."
reach
"Blockade of IK (DR) with short hairpin RNA or human ether-a-go-go 1 (hEAG1) channel blockers, 4-AP and astemizole, significantly reduced the rate of proliferation of human iPSC-MSCs."
reach
"Eag silencing reduces the proliferation of osteosarcoma cells."
reach
"In particular, transfection of Eag1 into mammalian cells confers a transformed phenotype and favors tumor progression in vivo, while inhibition of Eag1 expression inhibits cell proliferation."
reach
"In addition, suppression of Eag1 expression in several cancer cell lines causes a significant reduction of cell proliferation, while ectopic expression of Eag1 induces aggressive tumors in immune deficient mice [XREF_BIBR - XREF_BIBR]."
reach
"In contrast to chemotherapeutic drugs, Eag1 RNAi has been shown to inhibit the proliferation of various cancer cell lines with minimal nonspecific side effects [XREF_BIBR]."
reach
"Open Channel Blockade of Eag1 Channels Reduces Tumor Progression in Vivo -- Because inhibition of Eag1 by the open channel blockers astemizole and imipramine has been reported to inhibit proliferation of several cell types in vitro, we tested if similar effects could be observed in vivo."
reach
"In addition, to further evaluate whether Eag1 suppresses cell proliferation and migration by downregulating STAT3-VEGF pathway, cells were transfected with STAT3 siRNA."
reach
"Previously, we showed that calcitriol via VDR inhibited Eag1 gene expression reducing breast cancer cell proliferation XREF_BIBR and Weber et al demonstrated that silencing Eag1 expression with siRNA resulted in similar antineoplastic effects XREF_BIBR."
reach
"The Eag blocker imipramine at 50 muM significantly inhibited the proliferation of SK-OV-3 cell lines at 72 hours of culture (P < 0.001; Figure XREF_FIG) while clofilium (100-3300 nM) did not show any effect on proliferation at any of the time points tested."
reach
"The proliferation of SK-OV-3 cells is significantly inhibited by both Eag and HERG blockers."
reach
"Imipramine or Eag shRNA significantly suppressed the proliferation of MG-63 cells in vitro and in vivo."
reach
"Cell proliferation of E6/E7 keratinocytes was decreased by Eag1 antibodies inhibiting channel activity and by the nonspecific Eag1 inhibitors imipramine and astemizole; the latter also increased apoptosis."
Astemizole affects KCNH1
| 4 4 34
Astemizole inhibits KCNH1.
| 3 4 25
| 3 4 25
reach
"Astemizole synergized calcitriol antiproliferative effects by downregulating CYP24A1, upregulating VDR and targeting Eag1."
sparser
"Open Channel Blockade of Eag1 Channels Reduces Tumor Progression in Vivo —Because inhibition of Eag1 by the open channel blockers astemizole and imipramine has been reported to inhibit proliferation of several cell types in vitro ( xref , xref ), we tested if similar effects could be observed in vivo ."
reach
"A possible role of hEag1 in leukemia cell proliferation could be shown by growth and migration inhibition of the hEag1 expressing cell lines PLB-985, K562, UT-7 and HEL and primary clinical samples by the potassium channel blockers astemizole, imipramine, the hEag1 specific monoclonal antibody mAb56 and siRNA knockdown [XREF_BIBR]."
sparser
"Inhibition of Eag1 by astemizole or by siRNA induced a decrease in cyclin D1 expression along with a strong decrease of pRb phosphorylation and an arrest of the cells in G1 phase of cell cycle."
reach
"With the purpose of analyzing a possible synergistic effect upon proliferation by inhibiting Eag1 expression and channel activity, we incubated our cells in the presence of calcitriol and the Eag1 blocker astemizole."
reach
"Since both astemizole and calcitriol inhibit EAG1 activity and expression, respectively, patients bearing EAG1 and VDR positive solid or metastatic tumors may benefit from this EAG1 double blocking strategy."
reach
"Different relevance of inactivation and F468 residue in the mechanisms of hEag1 channel blockage by astemizole, imipramine and dofetilide."
reach
"At clinically achievable concentrations, astemizole synergized calcitriol antiproliferative effects by downregulating CYP24A1, upregulating VDR and targeting Eag1."
reach
"HEag1 channels recorded in these conditions were blocked by bath applications of imipramine (XREF_FIG A) and astemizole (XREF_FIG B)."
reach
"Tumor growth induced by implantation of Eag1 expressing cells was clearly inhibited in the group treated with astemizole (XREF_FIG), similar to growth inhibition observed after treatment with the well established cytotoxic drug cyclophosphamide (CPM) (applied at the maximal tolerable dose of 5 mg/kg)."
reach
"The small molecule EAG1 blocker astemizole reduced EAG1 expressing cancer cell growth in vitro and in vivo."
reach
"Interestingly, a nuclear localization sequence (NLS) has been found in Eag1 channels and currents resembling Eag1 channel activity blocked by astemizole have been recorded in the inner nuclear membrane [XREF_BIBR]."
reach
"Astemizole permeates the cell membrane and inhibits Eag1 currents by selectively binding to open channels."
reach
"Inhibition of Eag1 by astemizole or by siRNA induced a decrease in cyclin D1 expression along with a strong decrease of pRb phosphorylation and an arrest of the cells in G1 phase of cell cycle."
reach
"HEag1 inhibition by the antihistamine astemizole, the tricyclic antidepressant imipramine or hEag1 specific monoclonal antibodies reduces tumor cell proliferation in vitro and in vivo [XREF_BIBR, XREF_BIBR, XREF_BIBR - XREF_BIBR]."
reach
"XREF_BIBR Thus, Eag1 channels are inhibited by astemizole and may be potential targets for cancer therapy."
reach
"Small molecule EAG1 blockers such as astemizole have shown efficacy in reducing EAG1 expressing cancer cell growth in vitro and in vivo."
reach
"In combination with routinely used induction therapeutics, the hEag1 blockers astemizole and mAb56 were able to increase the apoptotic response in PLB-985 cells."
sparser
"Astemizole, an anti-histamine, is able to inhibit both Kv10.1 and Kv11.1 channels, contributing to inhibition of cancer cell proliferation in vitro and in vivo [ xref , xref , xref ]."
reach
"This cell line expresses Eag1, but not HERG (a relative of Eag1 that is very effectively blocked by astemizole and has also been implicated in tumor progression)."
reach
"Astemizole can inhibit Eag1 and Erg channel activity and decrease tumor cell proliferation both in vitro and in vivo [XREF_BIBR]."
reach
"Astemizole inhibits Eag1 and Erg channel activity, and in cells expressing the Eag1 channel it decreases tumor cell proliferation in vitro and in vivo."
reach
"This finding suggests either (a) that astemizole blocks hEag1 channels by binding in its uncharged form or (b) that the binding site lies out of the major drop of transmembrane potential."
reach
"Dose dependent Inhibition of hEag1 Currents by Imipramine and Astemizole."
sparser
"HEag1 inhibition by the antihistamine astemizole, the tricyclic antidepressant imipramine or hEag1 specific monoclonal antibodies reduces tumor cell proliferation in vitro and in vivo [ xref , xref , xref - xref ]."
reach
"However, the fact that astemizole reduced Eag1 mRNA in this study might be secondary to H 1 receptor antagonism and subsequent inactivation of downstream signaling pathways associated with generation of second messengers and proliferation."
reach
"Both outward and inward currents through channels that had constitutive activity could be blocked by the K V 10.1 blocker astemizole."
reach
"EAG1 activity may be reduced by preventing its phosphorylation with epidermal growth factor receptor (EGFR) kinase inhibitors and by astemizole, which blocks the channel pore and downregulates its gene expression."
reach
"Suppression of Eag1 by astemizole or pKv10.1-3 sensitizes cells to TMZ."
Astemizole decreases the amount of KCNH1.
| 1 4
Astemizole decreases the amount of KCNH1. 4 / 4
| 1 4
reach
"XREF_BIBR, XREF_BIBR, XREF_BIBR, XREF_BIBR In addition, astemizole potentiates the effect of other anticancer drugs in leukemia and breast cancer cells and downregulates Eag1 mRNA expression in breast cancer cells; in addition, astemizole binds to chromatine."
reach
"As depicted in XREF_FIG, calcitriol or astemizole alone slightly reduced Eag1 and Ki-67 gene expression in IDC-1; however, when used concomitantly, a significant inhibition of gene expression was observed for both genes."
reach
"Interestingly, the expression of EAG1 was also inhibited by astemizole, in a similar manner as observed previously in vitro [XREF_BIBR]."
reach
"Previous in vitro studies by our group have shown that astemizole, a non selective EAG1 blocker, synergized with calcitriol to inhibit breast cancer cell proliferation by modifying EAG1 gene expression and possibly its activity as well [XREF_BIBR]."
Astemizole activates KCNH1.
| 3
| 3
reach
"Astemizole, a new promising antineoplastic drug, targets Eag1 by blocking ion currents."
reach
"Chemical blockers : Imipramine and astemizole have been shown to abolish Eag currents and inhibit the cell proliferation of tumour cells and are easily available in the market for use [XREF_BIBR, XREF_BIBR]."
reach
"In addition, we found that astemizole induced subcellular accumulation of Eag1 channels."
Astemizole increases the amount of KCNH1.
| 1
Astemizole increases the amount of KCNH1. 1 / 1
| 1
reach
"In addition, both astemizole and calcitriol negatively targeted Eag1 gene expression, which together with the functional blockade of Eag1 channel activity by astemizole, may further explain the highly effective antiproliferative effects of the combined treatment, as reflected herein in the synergistic inhibition of cell growth and Ki-67 expression."
Astemizole binds KCNH1.
| 1
reach
"Taken together, all results are consistent with the idea that both imipramine and astemizole bind to hEag1 channels in their charged forms from the intracellular side."
CALM affects KCNH1
| 14 12 21
CALM binds KCNH1.
| 11 8 11
| 11 8 11
reach
"This indicates that the C-terminus of hEAG1 only binds CaM in its Ca 2+ -bound state."
sparser
"Calmodulin interaction with hEAG1 visualized by FRET microscopy."
reach
"The binding of CaM to hEAG1 is, in contrast to Ca (2+)-activated potassium channels, Ca (2+) dependent, with an apparent K (D) of 480 nM."
sparser
"The binding of CaM to hEAG1 is, in contrast to Ca(2+)-activated potassium channels, Ca(2+) dependent, with an apparent K(D) of 480 nM."
sparser
"Mutations at these two sites completely abolished CaM binding to hEAG1, indicating that the BD-N and BD-C2 binding domains are required for CaM binding."
sparser
"CaM binds Eag1 in the presence of Ca 2+ and inhibits ion conduction ( xref ) ( xref , xref )."
reach
"Mutations at these two sites completely abolished CaM binding to hEAG1, indicating that the BD-N and BD-C2 binding domains are required for CaM binding."
sparser
"The basis for this effect is observed in the structure of Eag1 bound to CaM as the closed pore is decoupled from the up or depolarized VS ( xref , xref )."
reach
"The basis for this effect is observed in the structure of Eag1 bound to CaM as the closed pore is decoupled from the up or depolarized VS (XREF_FIG, XREF_FIG)."
reach
"The recent CaM bound cryo-EM structure model of rat EAG1 channels provided more detailed information [XREF_BIBR]."
sparser
"We determined the single-particle cryo-electron microscopy structure of mammalian K(v)10.1, or Eag1, bound to the channel inhibitor calmodulin, at 3.78 angstrom resolution."
reach
"Mutations at these sites completely abolished CaM binding to hEAG1."
reach
"The combined four mutations F151S, A152S, F714S, F717S are therefore sufficient to hinder the binding of CaM to hEAG1 (p> 0.05) BD-C1 and other auxiliary sites can still be involved in the binding mechanism in a cooperative manner."
reach
"Calmodulin interaction with hEAG1 visualized by FRET microscopy."
reach
"We conclude that these two CaM binding sites, the high-affinity 1-8-14 CaM binding domain in the N-terminus and the previously described C-terminal binding domain at AA 707-276, are the major binding sites involved in CaM binding to EAG1."
reach
"CaM binds Eag1 in the presence of Ca 2+ and inhibits ion conduction (XREF_FIG)."
sparser
"Indeed, the N- and C-terminal domains of hEag1 interacts with calmodulin (Schönherr et al., xref ; Ziechner et al., xref ; Gonçalves and Stühmer, xref ), cortactin (Herrmann et al., xref ); KCa3.1 channels interact with ERK1/2 (Millership et al., xref ), and HERG1 channels with the adaptor protein 14-3-3 (Kagan et al., xref ), Src tyrosine kinase (Cayabyab and Schlichter, xref ), and the TNF-α receptor (Wang et al., xref )."
sparser
"Mutations at these sites completely abolished CaM binding to hEAG1."
reach
"The further inspection of CaM bound EAG1 structure showed that all three previously identified CaM binding sites are occupied by one CaM and four CaM molecules are bound to the functional tetramer channel."
CALM inhibits KCNH1.
| 3 4 9
CALM inhibits KCNH1. 10 / 10
| 3 4 6
reach
"Moreover, calmodulin (CaM) and Ca 2+ / CaM dependent protein kinase II, two Ca 2+ -binding and activated molecules widely implicated in synaptic signaling mechanisms 12, 13, serve as dynamic binding partners of mammalian Eag1 and Drosophila Eag channels, respectively 14, 15, 16, 17; for example, CaM binds to and inhibits the function of mammalian Eag1 in a Ca 2+ -dependent manner."
reach
"This suggests that the integrity of the PAS-CNBh interaction is important for the mechanism of CaM mediated EAG1 channel inhibition and supports a recent electrophysiological analysis of hEAG1 inhibition by CaM."
reach
"Among them, Ca 2+ / calmodulin (CaM) potently inhibits the EAG1 channel by binding to up to three discrete intracellular areas located in its N and C termini XREF_BIBR XREF_BIBR XREF_BIBR."
sparser
"However, understanding the molecular interactions that regulate hEAG1 channels could help in the design of novel therapies that mimic Ca 2+ -CaM inhibition of hEAG1 to selectively target hEAG1-expressing cancer cells."
reach
"This suggests that the integrity of the PAS-CNBh interaction is important for the mechanism of CaM mediated EAG1 channel inhibition and supports a recent electrophysiological analysis of hEAG1 inhibition by CaM (Lorinczi et al., 2016)."
sparser
"This suggests that the integrity of the PAS-CNBh interaction is important for the mechanism of CaM-mediated EAG1 channel inhibition and supports a recent electrophysiological analysis of hEAG1 inhibition by CaM ( Lorinczi et al., 2016 )."
sparser
"This suggests that the integrity of the PAS-CNBh interaction is important for the mechanism of CaM-mediated EAG1 channel inhibition and supports a recent electrophysiological analysis of hEAG1 inhibition by CaM ( xref )."
reach
"Ca 2+ / CaM could then inhibit hEAG1 channels, dampening the direct stimulatory effect of PIP 2 depletion on the channels described here."
reach
"In addition, Eag1 is inhibited by the binding of calmodulin (CaM) only in the presence of calcium."
sparser
"EAG1 is strongly inhibited by Ca 2+ -calmodulin (CaM) through a mechanism that is not understood."
Mutated CALM inhibits KCNH1. 2 / 2
| 2
reach
"The local conformation model emerges out of the previously published observation that the mutant CaM EF12 (where the N-lobe does not bind Ca 2+) is able to inhibit the hEAG1 channel, although with reduced potency : wild-type CaM at 270 nM reduced channel current to ~ 9%, while CaM-EF12 at a 4x higher concentration reduced the current to ~ 30%."
reach
"It was also shown that the mutant CaM EF12, i.e. a CaM in which the N-lobe EF hands 1 and 2 no not bind Ca 2+, is able to inhibit the hEAG1 channel, albeit with reduced potency, while the C-lobe mutant CaM EF34 (no Ca 2+ binding at the C-lobe) does not inhibit the channel even at a concentration of 1 muM."
CALM bound to calcium(2+) inhibits KCNH1. 1 / 1
| 1
reach
"It was also shown that the mutant CaM EF12, i.e., a CaM in which the N-lobe EF hands 1 and 2 do not bind Ca 2+, is able to inhibit the hEAG1 channel, albeit with reduced potency, while the C-lobe mutant CaM EF34 (no Ca 2+ binding at the C lobe) does not inhibit the channel even at a concentration of 1 muM (Ziechner et al., 2006)."
CALM decreases the amount of KCNH1.
| 1
CALM decreases the amount of KCNH1. 1 / 1
| 1
reach
"In other words, despite their striking difference in Ca 2+ requirement for physical association with the K + channel, both centrin 4 and CaM suppress Eag1 current level in a Ca 2+ -dependent manner."
Calcitriol affects KCNH1
| 2 1 23
Calcitriol decreases the amount of KCNH1.
| 2 12
Calcitriol decreases the amount of KCNH1. 12 / 12
| 2 12
reach
"Calcitriol dose-responsively inhibited Eag1 and Ki-67 gene expression in both cell lines (P < 0.05, XREF_FIG)."
reach
"RT real-time PCR and immunocytochemistry showed that calcitriol suppressed Eag1 expression by a vitamin D receptor (VDR)-dependent mechanism."
reach
"For instance, calcitriol, the active metabolite of vitamin D with known antiproliferative effects, down-regulates Eag1 expression in breast tumor derived cells and in cervical cancer [XREF_BIBR, XREF_BIBR]."
reach
"In fact, this is the first time that inhibition of the oncogenic potassium channel Eag1 expression by calcitriol is reported."
reach
"Inhibition of Eag1 mRNA expression by calcitriol was also corroborated in MDA-MB-231 cells, which further supported our observations in tumor derived cells."
reach
"Previously, our laboratory showed that EAG1 expression and the rate of cell proliferation are inhibited in breast and cervical cancer cells by calcitriol, the active vitamin D metabolite [XREF_BIBR, XREF_BIBR]."
reach
"In this study we tested a possible synergistic effect of the antihistamine astemizole, which inhibits Eag1 currents by selectively binding to open channels; and calcitriol, which inhibits Eag1 expression."
reach
"As shown in Figure XREF_FIG, calcitriol per se significantly downregulated tumor EAG1 gene expression, which was further reduced when calcitriol and astemizole were administrated simultaneously."
reach
"Calcitriol inhibited Eag1 gene expression in MDA-MB-231 cells, but to a lesser extent of that seen in breast tumor derived cells."
reach
"Previously, we have shown that hEAG1 expression is downregulated by calcitriol in a variety of cancer cells."
reach
"As depicted in XREF_FIG, calcitriol or astemizole alone slightly reduced Eag1 and Ki-67 gene expression in IDC-1; however, when used concomitantly, a significant inhibition of gene expression was observed for both genes."
reach
"In this regard, evidence has been provided showing that the expression of KCNH1 is significantly inhibited by calcitriol in vitro in different types of breast and cervical cancer cells and in vivo in human breast cancer tumors xenografted in athymic mice [XREF_BIBR, XREF_BIBR, XREF_BIBR]."
Calcitriol inhibits KCNH1.
| 1 7
| 7
reach
"Calcitriol decreased EAG1 mRNA in all cell types, and EAG1 protein and proliferation in SiHa cells."
reach
"On the other hand, even if calcitriol consistently down-regulated Eag-1 in all cell lines tested, and the effect of both drugs combined upon inhibition of cell proliferation and Ki-67 expression was synergistic, the significant downregulation of Eag1 mRNA observed with the combination of astemizole plus calcitriol in IDC-1 was not detected in SUM-229PE cells."
reach
"Since both astemizole and calcitriol inhibit EAG1 activity and expression, respectively, patients bearing EAG1 and VDR positive solid or metastatic tumors may benefit from this EAG1 double blocking strategy."
reach
"In addition, calcitriol significantly inhibited tumoral EAG1 mRNA and protein expression, an effect that was further increased by the co-administration with astemizole, showing for the first time the in vivo inhibition of this oncogenic potassium channel by these drugs in breast tumors."
reach
"EAG1 mRNA was more potently inhibited by calcitriol in VDR transfected cells."
reach
"Therefore, the rationale of the combined therapy proposed herein is based on Eag1 gene expression inhibition by calcitriol, together with the functional blockade of K + currents through this particular channel by astemizole, in order to potentiate the antineoplastic effects of both compounds."
reach
"In these studies the calcitriol dependent downregulation of Eag1 was accompanied by inhibition of cell proliferation and reduction of tumor growth."
| 1
sparser
"Therefore, the rationale of the combined therapy proposed herein is based on Eag1 gene expression inhibition by calcitriol, together with the functional blockade of K + currents through this particular channel by astemizole, in order to potentiate the antineoplastic effects of both compounds."
Calcitriol increases the amount of KCNH1.
| 3
Calcitriol increases the amount of KCNH1. 3 / 3
| 3
reach
"Inhibition of Eag1 mRNA expression by calcitriol was also corroborated in MDA-MB-231 cells, which further supported our observations in tumor derived cells."
reach
"In addition, both astemizole and calcitriol negatively targeted Eag1 gene expression, which together with the functional blockade of Eag1 channel activity by astemizole, may further explain the highly effective antiproliferative effects of the combined treatment, as reflected herein in the synergistic inhibition of cell growth and Ki-67 expression."
reach
"In fact, this is the first time that inhibition of the oncogenic potassium channel Eag1 expression by calcitriol is reported."
Calcitriol activates KCNH1.
| 1
| 1
reach
"Gene expression of cyclin D1 (CCND1), and Ether-a-go-go 1 (EAG1) was also evaluated in cells treated with calcitriol alone or in combination with estradiol or ICI-182,780."
KCNH1 affects CALM
| 11 8 11
| 11 8 11
reach
"This indicates that the C-terminus of hEAG1 only binds CaM in its Ca 2+ -bound state."
sparser
"Calmodulin interaction with hEAG1 visualized by FRET microscopy."
reach
"The binding of CaM to hEAG1 is, in contrast to Ca (2+)-activated potassium channels, Ca (2+) dependent, with an apparent K (D) of 480 nM."
sparser
"The binding of CaM to hEAG1 is, in contrast to Ca(2+)-activated potassium channels, Ca(2+) dependent, with an apparent K(D) of 480 nM."
sparser
"Mutations at these two sites completely abolished CaM binding to hEAG1, indicating that the BD-N and BD-C2 binding domains are required for CaM binding."
sparser
"CaM binds Eag1 in the presence of Ca 2+ and inhibits ion conduction ( xref ) ( xref , xref )."
reach
"Mutations at these two sites completely abolished CaM binding to hEAG1, indicating that the BD-N and BD-C2 binding domains are required for CaM binding."
sparser
"The basis for this effect is observed in the structure of Eag1 bound to CaM as the closed pore is decoupled from the up or depolarized VS ( xref , xref )."
reach
"The basis for this effect is observed in the structure of Eag1 bound to CaM as the closed pore is decoupled from the up or depolarized VS (XREF_FIG, XREF_FIG)."
reach
"The recent CaM bound cryo-EM structure model of rat EAG1 channels provided more detailed information [XREF_BIBR]."
sparser
"We determined the single-particle cryo-electron microscopy structure of mammalian K(v)10.1, or Eag1, bound to the channel inhibitor calmodulin, at 3.78 angstrom resolution."
reach
"Mutations at these sites completely abolished CaM binding to hEAG1."
reach
"The combined four mutations F151S, A152S, F714S, F717S are therefore sufficient to hinder the binding of CaM to hEAG1 (p> 0.05) BD-C1 and other auxiliary sites can still be involved in the binding mechanism in a cooperative manner."
reach
"Calmodulin interaction with hEAG1 visualized by FRET microscopy."
reach
"We conclude that these two CaM binding sites, the high-affinity 1-8-14 CaM binding domain in the N-terminus and the previously described C-terminal binding domain at AA 707-276, are the major binding sites involved in CaM binding to EAG1."
reach
"CaM binds Eag1 in the presence of Ca 2+ and inhibits ion conduction (XREF_FIG)."
sparser
"Indeed, the N- and C-terminal domains of hEag1 interacts with calmodulin (Schönherr et al., xref ; Ziechner et al., xref ; Gonçalves and Stühmer, xref ), cortactin (Herrmann et al., xref ); KCa3.1 channels interact with ERK1/2 (Millership et al., xref ), and HERG1 channels with the adaptor protein 14-3-3 (Kagan et al., xref ), Src tyrosine kinase (Cayabyab and Schlichter, xref ), and the TNF-α receptor (Wang et al., xref )."
sparser
"Mutations at these sites completely abolished CaM binding to hEAG1."
reach
"The further inspection of CaM bound EAG1 structure showed that all three previously identified CaM binding sites are occupied by one CaM and four CaM molecules are bound to the functional tetramer channel."
TP53 affects KCNH1
| 14
TP53 increases the amount of KCNH1.
| 7
TP53 increases the amount of KCNH1. 7 / 7
| 7
reach
"Moreover, the activation of p53 by nutlin-3 induced cell growth arrest in MG-63 cells and reduced Eag protein level, while the inactivation of p53 by pifithrin-alpha (PFT-alpha) promoted MG-63 cell growth and increased Eag protein expression."
reach
"XREF_BIBR It has been suggested that mutated or inactive p53 increases Eag1 expression; p53 is mutated in most tumors including HCC."
reach
"Inactivation of p53 activity, as is the case in many cancers, can thus cause oncogenic overexpression of h-eag1 by relieving the negative feed-forward regulation."
reach
"On the other hand, the downregulation of h-eag1 expression induced by co-application of p53 activator and miR-34a was abolished by E2F1 overexpression (XREF_FIG)."
reach
"Furthermore, p53 could modulate the expression of Eag in MG-63 cells as shown by the use of p53 activator and inhibitor."
reach
"On the other hand, inactivation of p53 by PFT-alpha promoted cell growth and increased Eag protein expression, which were abrogated by Eag-shRNA (XREF_FIG)."
reach
"When Eag expression is high, it activates p38 MAPK, which in turn inactivates p53 and relieves the inhibition of Eag expression by p53."
TP53 decreases the amount of KCNH1.
| 7
TP53 decreases the amount of KCNH1. 7 / 7
| 7
reach
"Therefore, p53 negatively regulates h-eag1 expression by a negative feed-forward mechanism through the p53-miR-34-E2F1 pathway and inactivation of p53 activity as it is the case in many cancers can thus cause oncogenic overexpression of h-eag1 by relieving the negative feed-forward regulation."
reach
"Moreover, the activation of p53 by nutlin-3 induced cell growth arrest in MG-63 cells and reduced Eag protein level, while the inactivation of p53 by pifithrin-alpha (PFT-alpha) promoted MG-63 cell growth and increased Eag protein expression."
reach
"Evidently, p53 negatively regulates expression of h-eag1."
reach
"This is consistent with a recent report that Eag expression is negatively regulated by p53 through p53-miR34-E2F1 pathway in human neuroblastoma cells SHSY5Y."
reach
"Activation of p53, which results in cell cycle arrest or apoptosis, reduced the expression of Eag1 channel."
reach
"A recent report showed that Eag1 expression was negatively regulated by p53 through p53-miR34-E2F1 pathway in human neuroblastoma cells XREF_BIBR."
reach
"Therefore, p53 negatively regulates h-eag1 expression by a negative feed-forward mechanism through the p53-miR-34-E2F1 pathway."
| 5 7
sparser
"Molecular determinants of hEAG1 channel inhibition by PIP 2 ."
reach
"Inhibition of hEAG1 channels by PIP 2."
sparser
"The PIP 2 inhibition of hEAG1 channels is physiologically relevant as evidenced by the observation that neuronal transmitter 5-HT noticeably increased the whole-cell current from the hEAG1 channels coexpressed with the serotonin receptor HTR 2A in HEK293 cells, suggesting that endogenous PIP 2 may exert a detectable tonic inhibitory influence on hEAG1 channels in intact neurons."
sparser
"The PIP 2 inhibition of hEAG1 channels is physiologically relevant as evidenced by the observation that neuronal transmitter 5-HT noticeably increased the whole-cell current from the hEAG1 channels coexpressed with the serotonin receptor HTR 2A in HEK293 cells, suggesting that endogenous PIP 2 may exert a detectable tonic inhibitory influence on hEAG1 channels in intact neurons."
reach
"PIP 2 quickly inhibited the hEAG1 channel when the membrane potential was held at 40mV (XREF_FIG, D)."
reach
"Physiological relevance of the tonic inhibitory influence of PIP 2 as an endogenous modulator of hEAG1 is further suggested by the finding that activation of serotonin HTR 2A receptors, known to activate PLC XREF_BIBR to promote hydrolysis of PIP 2, also increases hEAG1 currents at negative voltages."
sparser
"Molecular determinants of hEAG1 channel inhibition by PIP 2 ."
reach
"The PIP 2 inhibition of hEAG1 channels is physiologically relevant as evidenced by the observation that neuronal transmitter 5-HT noticeably increased the whole-cell current from the hEAG1 channels coexpressed with the serotonin receptor HTR 2A in HEK293 cells, suggesting that endogenous PIP 2 may exert a detectable tonic inhibitory influence on hEAG1 channels in intact neurons."
reach
"We found that depletion of endogenous PIP 2 by activation of the voltage sensing phosphatase from Danio rerio (Dr-VSP) or the human muscarinic type-1 receptor (hM1R) inhibits hEAG1 currents; however, the application of exogenous PIP 2 to increase the level of this lipid on the plasma membrane, also induced an inhibition of hEAG1."
reach
"In this case, PIP 2 inhibits hEAG1 channels through a mechanism that requires an intact CaM BD-N region."
sparser
"To test whether PIP 2 directly interacts with the hEAG1 channel, we used bio-layer interferometry (BLI) to measure the kinetics of binding of PIP 2 to the purified hEAG1 channel complex."
reach
"Our findings show that the hEAG1 channel is directly regulated by PIP 2 and that this regulation may contribute to normal human physiology and pathology."
Imipramine affects KCNH1
| 10
Imipramine inhibits KCNH1.
| 8
| 8
reach
"First, Eag1 blockers imipramine and astemizole were shown to reduce tumor cell growth."
reach
"Dose dependent Inhibition of hEag1 Currents by Imipramine and Astemizole."
reach
"Both Eag blockers imipramine 50 muM and clofilum 3300 etaM demonstrated no effect on the G0/G1, S or G2M phases of the cell cycle."
reach
"Different relevance of inactivation and F468 residue in the mechanisms of hEag1 channel blockage by astemizole, imipramine and dofetilide."
reach
"The Eag blocker imipramine at 50 muM significantly inhibited the proliferation of SK-OV-3 cell lines at 72 hours of culture (P < 0.001; Figure XREF_FIG) while clofilium (100-3300 nM) did not show any effect on proliferation at any of the time points tested."
reach
"HEag1 inhibition by the antihistamine astemizole, the tricyclic antidepressant imipramine or hEag1 specific monoclonal antibodies reduces tumor cell proliferation in vitro and in vivo [XREF_BIBR, XREF_BIBR, XREF_BIBR - XREF_BIBR]."
reach
"Inhibition of hEag1 by imipramine and mAb56 reduced the migration of HEL and PLB-985 cells up to 65%, indicating an implication of the channel activity in this phenomenon."
reach
"HEag1 channels recorded in these conditions were blocked by bath applications of imipramine (XREF_FIG A) and astemizole (XREF_FIG B)."
Imipramine binds KCNH1.
| 1
reach
"Imipramine Binding to hEag1."
Imipramine activates KCNH1.
| 1
| 1
reach
"Chemical blockers : Imipramine and astemizole have been shown to abolish Eag currents and inhibit the cell proliferation of tumour cells and are easily available in the market for use [XREF_BIBR, XREF_BIBR]."
KCNH1 affects cell growth
| 10
KCNH1 activates cell growth.
| 6
| 5
reach
"First, Eag1 blockers imipramine and astemizole were shown to reduce tumor cell growth."
reach
"Finally, we investigated signaling mechanism by which Eag1 promotes liposarcoma cell growth and cycle."
reach
"Furthermore, cancer cells overexpress Eag1, which contributes to cell growth and tumor expansion."
reach
"Downregulation of miR-34 should produce the opposite changes and upregulation of h-eag1 may mediate the cell growth promoting effect of miR-34 downregulation."
reach
"The specific blockade of KCNH1 by monoclonal antibodies inhibited tumor cell growth both in vitro and in vivo [XREF_BIBR]."
Mutated KCNH1 activates cell growth. 1 / 1
| 1
reach
"Ectopic expression of pore dead mutant Eag1, in CHO cells, promotes cell growth in vitro and in vivo (xenografts)."
KCNH1 inhibits cell growth.
| 4
| 4
reach
"Ectopic expression of EAG1 significantly rescued miR-296-3p-induced inhibition of cell growth and drug resistance."
reach
"Further, inactivation of p53 by PFT-alpha or MT-AMO promoted cell growth, which was abrogated by the antisense to h-eag1 (XREF_FIG)."
reach
"Thus, cysteine oxidation of KCNH1 by ROS in cancer cells is expected to inhibit cancer cell growth."
reach
"The small molecule EAG1 blocker astemizole reduced EAG1 expressing cancer cell growth in vitro and in vivo."
KCNH1 affects E2F1
| 4 9 1
KCNH1 binds E2F1.
| 4 9
| 4 6
sparser
"To test whether Kv10.1 expression is under the influence of the cell cycle through the pRb/E2F1 pathway, we abolished the binding of the E2F1 transcription factor to the promoter region of Kv10.1, reduced the pRb suppression on E2F1 through HPV-E7 overexpression, and examined the consequences in the Kv10.1 promoter activity as well as protein expression in thymidine synchronized HeLa cells."
sparser
"E2F1 preferentially binds to Kv10.1 promoter toward G2/M, resulting in restricted expression of the channel during a short time window in G2/M in cancer cells, and interestingly also in normal proliferating cells."
sparser
"The interaction between E2F1 and the Kv10.1 promoter was significantly increased when the cells reached the G2/M transition."
sparser
"In proliferating cells, E2F1 transcription factor binds directly to the Kv10.1 promoter during (or close to) G2/M, resulting in transient expression of the channel."
sparser
"Interaction of E2F1 with the Kv10.1 promoter occurs during G2/M."
sparser
"To validate whether E2F1 directly binds to the Kv10.1 promoter in vivo , we conducted ChIP experiments pulling down E2F1 in synchronized HeLa cells, and checked the presence of the endogenous Kv10.1 promoter region covering the predicted E2F1 binding site using qRT-PCR on the immunoprecipitated fraction."
CCNA2 binds E2F1 and KCNH1. 3 / 3
| 3
sparser
"As soon as mitosis was completed and the cells re-entered the cell cycle (12 h), E2F1 binding to either Kv10.1 or Cyclin A2 promoters was dramatically diminished."
sparser
"As the cells passed through the G1/S border and S phase (0 h and 4 h respectively), binding of E2F1 to Kv10.1 and cyclin A2 promoters was less prominent."
sparser
"We found that E2F1 interacts with both Kv10.1 and Cyclin A2 promoters in a cell-cycle dependent manner ( xref )."
KCNH1 activates E2F1.
| 1
KCNH1 activates E2F1. 1 / 1
| 1
reach
"Eag1 silencing by antisense oligonucleotides reduced the growth stimulation effect of E2F1 and, in addition, abrogated the effects of p53 inactivation."
E2F1 affects KCNH1
| 6 9 1
E2F1 binds KCNH1.
| 4 9
| 4 6
sparser
"To test whether Kv10.1 expression is under the influence of the cell cycle through the pRb/E2F1 pathway, we abolished the binding of the E2F1 transcription factor to the promoter region of Kv10.1, reduced the pRb suppression on E2F1 through HPV-E7 overexpression, and examined the consequences in the Kv10.1 promoter activity as well as protein expression in thymidine synchronized HeLa cells."
sparser
"E2F1 preferentially binds to Kv10.1 promoter toward G2/M, resulting in restricted expression of the channel during a short time window in G2/M in cancer cells, and interestingly also in normal proliferating cells."
sparser
"The interaction between E2F1 and the Kv10.1 promoter was significantly increased when the cells reached the G2/M transition."
sparser
"In proliferating cells, E2F1 transcription factor binds directly to the Kv10.1 promoter during (or close to) G2/M, resulting in transient expression of the channel."
sparser
"Interaction of E2F1 with the Kv10.1 promoter occurs during G2/M."
sparser
"To validate whether E2F1 directly binds to the Kv10.1 promoter in vivo , we conducted ChIP experiments pulling down E2F1 in synchronized HeLa cells, and checked the presence of the endogenous Kv10.1 promoter region covering the predicted E2F1 binding site using qRT-PCR on the immunoprecipitated fraction."
CCNA2 binds E2F1 and KCNH1. 3 / 3
| 3
sparser
"As soon as mitosis was completed and the cells re-entered the cell cycle (12 h), E2F1 binding to either Kv10.1 or Cyclin A2 promoters was dramatically diminished."
sparser
"As the cells passed through the G1/S border and S phase (0 h and 4 h respectively), binding of E2F1 to Kv10.1 and cyclin A2 promoters was less prominent."
sparser
"We found that E2F1 interacts with both Kv10.1 and Cyclin A2 promoters in a cell-cycle dependent manner ( xref )."
E2F1 increases the amount of KCNH1.
| 2 1
E2F1 increases the amount of KCNH1. 1 / 1
| 2 1
reach
"p53 activates miR-34 transcription; upregulation of miR-34 represses E2F1 and h-eag1; repression of E2F1 downregulates expression of h-eag1."
| 9
Isocyanic acid activates KCNH1.
| 8
Isocyanic acid activates KCNH1-F359L. 5 / 5
| 5
reach
"The homologous mutation in hEAG1 (F359L) also dramatically altered drug action; instead of inhibition, ICA activated F359L hEAG1."
reach
"Moreover, opposite to WT hEAG1 channels, but similar to WT hERG1, F359L hEAG1 channels were activated by ICA."
reach
"Thus, ICA is an activator of F359L hEAG1 and an inhibitor of F359L and Y464A hEAG1 channels, indicating that Phe359 in S5 is required for ICA to induce open-state inactivation, as well as demonstrating that Tyr464 in S6 is required for the activator effect of ICA on F359L hEAG1 channels."
reach
"F359L hEAG1 is activated by ICA."
reach
"Instead, we found that ICA increased F359L hEAG1 channel currents by 5.4 +/- 0.6-fold at 10 microM (n = 3) without any evident change in kinetics (XREF_FIG)."
reach
"ICA enhances inactivation of hEAG1 channels."
reach
"Instead, we found that ICA appeared to enhance inactivation of hEAG1."
reach
"When mutated to Leu (F359L), ICA activates hEAG1, whereas it inhibits F359L and Y464A channel currents."
Isocyanic acid inhibits KCNH1.
| 1
reach
"Instead, we found that ICA inhibited hEAG1 in a voltage dependent manner consistent with an enhancement of its intrinsic slow inactivation gating process."
KCNH1 affects p38
| 1 8
KCNH1 activates p38.
| 8
KCNH1 activates p38. 8 / 8
| 8
reach
"Taken together, these data indicate that Eag1 knockdown may inhibit the activation of p38 MAPK which then promotes growth and cell cycle arrest in liposarcoma cells."
reach
"To explore the molecular mechanism underlying the oncogenic role of Eag1 in liposarcoma, we focused on p38 MAPK pathway because Eag1 has been shown to activate p38 MAPK pathway [XREF_BIBR], which is frequently activated in a variety of tumors [XREF_BIBR]."
reach
"Taken together, these data indicate that high expression of Eag may induce the activation of p38 MAPK which then promotes the proliferation of MG-63 cells."
reach
"XREF_BIBR Therefore, it is possible that overexpression of Eag induces the activation of p38 MAPK which then promotes the proliferation of osteosarcoma cells because we showed that the inhibition of p38 MAPK and p53 pathway led to reduced MG-63 cell proliferation."
reach
"Therefore, it is possible that Eag1 overexpression induces the activation of p38 MAPK and promotes tumorigenesis."
reach
"Eag has also been shown to activate p38 MAPK and stimulate proliferation of several cell lines in a voltage dependent manner that does not require ion flux."
reach
"Eag1 Silencing Reduces p38 MAPK Activity in Liposarcoma Cells."
reach
"We demonstrated that Eag1 knockdown inhibits the activation of p38 MAPK which then may induce the growth and cell cycle arrest of liposarcoma cells."
KCNH1 binds p38.
| 1
| 1
sparser
"These data suggest that Eag and p38 MAPK may form a positive feedback loop to maintain the high expression of Eag in osteosarcoma cells."
KCNH1 affects VEGF
| 1 1 8
KCNH1 increases the amount of VEGF.
| 4
KCNH1 increases the amount of VEGF. 4 / 4
| 4
reach
"Western blot analysis showed that VEGF expression was suppressed in Ad5-Eag1-shRNA group compared with Ad5-Control-shRNA group or saline group (XREF_FIG), indicating that the anti-tumor effects of Eag1 silencing on osteosarcoma are related to decreased angiogenesis and reduced VEGF expression."
reach
"So we examined the expression level of VEGF using Western blot analysis and the results showed that Eag1 knockdown leads to reduced expression of VEGF in MG-63 and Saos-2 cells."
reach
"We found that Eag1 silencing not only suppressed angiogenesis in osteosarcoma but also reduced the expression of VEGF."
reach
"This result suggested that Eag1 may upregulate the expression of VEGF in OS cells, consistent with the results that cancer cells express Eag1 show significantly higher levels of VEGF secretion than controls [XREF_BIBR]."
KCNH1 activates VEGF.
| 1 3
KCNH1 activates VEGF. 3 / 3
| 1 3
reach
"Eag channels also appear to impart a selective advantage for tumour cells in hypoxia by production of hypoxia inducible factor-1 (HIF-1) and thereby increasing vascular endothelial growth factor (VEGF) and increased vascularisation [XREF_BIBR]."
reach
"To investigate whether Eag1 silencing was able to inhibit intracellular signal transduction of VEGF, we first detected the expression of VEGF in MG-63 cells at different time points after Ad5-Eag1shRNA treatment."
reach
"Eag1 Expression Promotes VEGF Secretion in Vitro -- Among the many factors influencing angiogenesis, VEGF appears to be predominant."
KCNH1 inhibits VEGF.
| 1
KCNH1 inhibits VEGF. 1 / 1
| 1
sparser
"To investigate whether Eag1 silencing was able to inhibit intracellular signal transduction of VEGF, we first detected the expression of VEGF in MG-63 cells at different time points after Ad5-Eag1shRNA treatment."
KCNH1 decreases the amount of VEGF.
| 1
KCNH1 decreases the amount of VEGF. 1 / 1
| 1
reach
"We found that Eag1 silencing led to decreased angiogenesis and VEGF expression in the xenograft model of osteosarcoma."
| 8
KCNH1 activates angiogenesis.
| 7
| 7
reach
"Our previous studies provide evidence that Eag1 promotes the growth and angiogenesis of OS and the downreguation of Eag1 by siRNA or microRNA-34a exhibited antitumor effects on OS [XREF_BIBR, XREF_BIBR]."
reach
"XREF_BIBR, XREF_BIBR In addition, Eag appears to induce tumor angiogenesis by the induction of functional increase of hypoxia inducible factor-1 (HIF-1) and the secretion of vascular endothelial growth factor (VGEF) upon hypoxia XREF_BIBR and participates in the acquisition of malignant phenotypes in lung tumor cell."
reach
"Taken together, our results suggest that Eag1 silencing inhibits tumor growth and angiogenesis in osteosarcoma via the down regulation of VEGF/PI3K/AKT signaling."
reach
"Eag1 expression interferes with hypoxia homeostasis and induces angiogenesis in tumors."
reach
"Collectively, this study provides the first lines of evidence that Eag1 silencing inhibits tumor growth and angiogenesis in osteosarcoma and these are associated with the downregulation of VEGF/PI3K/AKT signaling."
reach
"Eag1 appears to induce tumor angiogenesis by the release of hypoxia inducible factor-1 (HIF-1) and vascular endothelial growth factor (VEGF) upon hypoxia [XREF_BIBR]."
reach
"Eag1 Silencing Inhibits Angiogenesis of Xenografted Osteosarcoma."
KCNH1 inhibits angiogenesis.
| 1
| 1
reach
"Short Hairpin RNA (shRNA) Ether a go-go 1 (Eag1) inhibition of human osteosarcoma angiogenesis via VEGF/PI3K/AKT signaling."
| 7
| 4
reach
"Based on the findings in previous studies that potassium voltage gated channel subfamily H member 1 (KCNH1) was overexpressed in osteosarcoma and promoted the proliferation and invasion of osteosarcoma [XREF_BIBR - XREF_BIBR] and on our profile of the miRanda, PITA, RNAhybrid databases to explore the corresponding circRNAs of KCNH1, we speculated that hsa-circ-0016347 may be a potential regulator of osteosarcoma progression."
reach
"The results demonstrated that Eag1 siRNAs lead to reduced adhesion, migration, and invasion of MG-63 and Saos-2 cells."
reach
"Conclusions : Eag1 may promote osteosarcoma cell proliferation and invasion by targeting STAT3-VEGF pathway and may be a potential therapeutic target for osteosarcoma."
reach
"Finally, we tried to explain the detailed mechanisms by which OS cell adhesion, migration, and invasion are inhibited by specific blockade of Eag1."
reach
"Eag1 Knockdown Inhibits Adhesion, Migration, and Invasion of OS Cells."
reach
"Our results showed that Eag1 siRNA can inhibit OS cells adhesion, migration, and invasion through the STAT3 and VEGF pathway."
reach
"Furthermore, to determine whether Eag1 siRNAs inhibit cell migration and invasion by downregulating STAT3, OS cells were transfected with STAT3 siRNA."
Pyraclofos affects KCNH1
| 6
Pyraclofos inhibits KCNH1.
| 5
| 5
reach
"Unexpectedly, the Y464A mutation alone was found to induce prominent voltage dependent inactivation of hEAG1 (XREF_FIG)."
reach
"The Eag domain regulates the voltage dependent inactivation of rat Eag1 K+ channels."
reach
"It is still unclear how the eag domain may regulate the voltage dependent inactivation of Eag1 K + channels."
reach
"Voltage dependent inactivation of hEAG1 channels."
reach
"The Eag Domain Regulates the Voltage Dependent Inactivation of Rat Eag1 K + Channels."
Pyraclofos activates KCNH1.
| 1
| 1
reach
"At this voltage, assuming that hEAG1 and Kv1.2/2.1 XREF_BIBR activate in a similar fashion, the voltage sensors are expected to be fully activated, placing hEAG1 K327 through R336 on the extracellular side and R339 interacting with negatively charged residues in S2 and S3."
Calcium(2+) affects KCNH1
| 4 6
Calcium(2+) inhibits KCNH1.
| 4 5
| 4 5
reach
"XREF_BIBR reported that the inhibition of hEAG1 by Ca 2+ was mediated by the direct binding of Ca 2+ / CaM to the C-terminus (AA 707-726) of the channel."
reach
"HEAG1 Inhibition by Ca 2+ i Is CaM mediated."
reach
"EAG1 is strongly inhibited by Ca 2+ -calmodulin (CaM) through a mechanism that is not understood."
reach
"HEAG1 Channels Lacking the PAS-cap Are Potentiated Rather than Inhibited by Ca 2+ i."
reach
"Consistently, by visualizing the interaction between YFP labeled CaM and Cerulean labeled hEAG1 in mammalian cells by Forster resonance energy transfer (FRET), Goncalves et al. [XREF_BIBR] found that the high affinity BD-N binding domain and the second C-terminal binding domain BD-C2 are predominantly involved in EAG1 channel inhibition by Ca 2+."
Calcium(2+) activates KCNH1.
| 1
| 1
reach
"Glu 600 on the cNBHD, when substituted with residues with a larger volume, resulted in hEAG1 currents that were profoundly potentiated by Ca 2+ i in a manner similar to the DeltaPAS cap mutant."
| 1 1 5
Arachidonic acid activates KCNH1.
| 1 1 4
| 1 1 4
reach
"Although known as an inhibitor of many K + channels [13], AA also has been demonstrated to stimulate hEAG1 [16], Kir2.3 [17], and the TREK subfamily of K2P channels, including TREK-1, TREK-2, and TRAAK [18]."
reach
"The neurological significance of EAG1 regulation by AA is not yet known; however, based on the wide distributions of AA and EAG1 in the nervous system, it is reasonable to expect that modulation of EAG1 by AA could play important roles in neuronal signaling and excitability."
reach
"Therefore, in particular at typical resting potentials of tumour cells (-30 mV), AA potently activated hEAG1 channels in a reversible manner."
sparser
"Therefore, in particular at typical resting potentials of tumour cells (-30 mV), AA potently activated hEAG1 channels in a reversible manner."
reach
"Activation of hEAG1 potassium channels by arachidonic acid."
| 1
reach
"Unlike other voltage gated K (+) channels, hEAG1 channels are not blocked by arachidonic acid."
| 6
| 4
reach
"Furthermore, Eag1 silencing increased the rate of rotenone induced apoptosis by 33% compared with control group as revealed by Hoechst assay (P = 0.025; XREF_FIG)."
reach
"HERG blockers inhibit the proliferation at S and G2/M phase while Eag blocker impramine increases early apoptosis in ovarian cancer cells with no effect on cell cycle."
reach
"In addition, silencing of Eag1 caused 11% induction of the rate of apoptosis in comparison with scramble (P = 0.013; XREF_FIG)."
reach
"Suppression of Eag1 increased the induction of apoptosis (Q4 and Q2) caused by TMZ (XREF_FIG)."
| 2
reach
"Both estrogen and HPV oncoproteins regulate Eag1 potassium channel, of which inhibition leads to apoptosis of human cervical cancer cells."
reach
"In addition, estrogen and HPV oncoproteins regulate Eag1 potassium channel, of which inhibition leads to apoptosis of human cervical cancer cells [XREF_BIBR]."
ESR1 affects KCNH1
5 | 1
ESR1 increases the amount of KCNH1.
5 |
Transcriptionally active ESR1 increases the amount of KCNH1. 5 / 5
5 |
biopax:ctd
No evidence text available
biopax:ctd
No evidence text available
biopax:ctd
No evidence text available
biopax:ctd
No evidence text available
biopax:ctd
No evidence text available
ESR1 binds KCNH1.
| 1
| 1
sparser
"Real-time RT-PCR experiments in HeLa cells showed that Eag1 estrogenic regulation was strongly associated with the expression of estrogen receptor-alpha."
EGFR affects KCNH1
| 1 6
EGFR inhibits KCNH1.
| 4
EGFR inhibits KCNH1. 4 / 4
| 4
reach
"The hEAG1 channels, like hERG channels, showed no response to EGF or orthovanadate, even after a 36-h starvation, and was suppressed by the EGFR kinase inhibitor AG556, indicating a saturated level of basal tyrosine phosphorylation."
reach
"We found that the highly selective EGFR kinase inhibitor AG556 [26] reversibly inhibited the hEAG1 current amplitude and modified the holding potential dependent activation kinetics."
reach
"We found that the selective epidermal growth factor receptor (EGFR) kinase inhibitor AG556 (10 muM), but not the platelet growth factor receptor (PDGFR) kinase inhibitor AG1295 (10 muM) or the Src family inhibitor PP2 (10 muM), can inhibit hEAG1 current, and the inhibitory effect can be reversed by the protein tyrosine phosphatase (PTP) inhibitor orthovanadate."
reach
"These results suggest that the EGFR kinase inhibitor AG556, but not PDGFR kinase inhibitor AG1295 or the Src family kinase inhibitor PP2, inhibits hEAG1 current in HEK cells stably expressing hEAG1 gene.To exclude the possibility that the decrease of hEAG1 current by AG556 was mediated by a direct channel block, the PTP inhibitor orthovanadate was employed to examine whether the inhibitory effect of AG556 on hEAG1 current is through EGFR kinase inhibition."
EGFR phosphorylates KCNH1.
| 1
EGFR leads to the phosphorylation of KCNH1 on tyrosine. 1 / 1
| 1
reach
"Interestingly, tyrosine phosphorylation level was remarkably reduced in hEAG1-HEK cells transfected with 40 nM siRNA targeting EGFR, supporting the notion that the saturated tyrosine phosphorylation of hEAG1 channels is mediated by EGFR kinase.To determine the molecular regulation sites of EGFR kinase, seven mutants at different tyrosine sites of hEAG1 channels were generated, including Y90A, Y344A, Y376A, Y479A, Y485A, Y639A and Y639F."
EGFR activates KCNH1.
| 1 1
EGFR activates KCNH1. 1 / 1
| 1 1
reach
"Fig. 5 shows that the modification of activation conductance and voltage dependent activation process induced by the EGFR kinase inhibitor AG556 could be significantly countered by the PTP inhibitor orthovanadate.If the hEAG1 current reduction by AG556 is mediated by EGFR kinase inhibition, tyrosine phosphorylation level of hEAG1 channel protein should be reduced by this inhibitor."
| 5
Temozolomide decreases the amount of KCNH1.
| 2
Temozolomide decreases the amount of KCNH1. 2 / 2
| 2
reach
"Eag1 was highly expressed in human U87MG glioblastoma cells (CTCF, 19.65 +/-0.76; XREF_FIG) while TMZ and the pKv10.1-3 vector decreased this expression of Eag1 (XREF_FIG)."
reach
"p53 protein negatively regulates Eag1; therefore, we hypothesize that TMZ, at least indirectly, may reduce Eag1 expression, amplifying the drug effects on glioma cells."
Temozolomide inhibits KCNH1.
| 1
| 1
reach
"pKv10.1-3 (0.2 microg) improved the Eag1 silencing caused by 250 microM TMZ, as determined by reverse transcription-quantitative polymerase chain reaction and immunocytochemistry."
Temozolomide increases the amount of KCNH1.
| 1
Temozolomide increases the amount of KCNH1. 1 / 1
| 1
reach
"The vector significantly enhanced the downregulation of Eag1 expression caused by TMZ on glioblastoma cells at 72 h. Eag1 mRNA content was reduced from 0.78-fold, for 250 microM TMZ alone to 0.31-fold for 250 microM TMZ plus pKv10.1-3 (P = 0.020; XREF_FIG)."
Temozolomide activates KCNH1.
| 1
| 1
reach
"Second, pKv10.1-3 in association with TMZ increased the silencing effect on Eag1 mRNA caused by TMZ alone (0.31- vs. 0.78-fold reduction; XREF_FIG)."
KCNH1 affects calcium(2+)
| 5
KCNH1 activates calcium(2+).
| 3
| 3
reach
"In our previous works, we reported that the inhibition of hEag1 channels reduces the concentration of intracellular calcium in synchronized cells in G1 phase [9]."
reach
"In line with this notion, Eag1 appears to modulate presynaptic Ca 2+ influx and neurotransmitter release during high-frequency neuronal firing 11."
reach
"Collagen 1 elicits an increase of Kv10.1 activation that enhances basal Ca 2+ influx through Orai1, triggering ERK1/2 activation and promoting cell survival."
KCNH1 inhibits calcium(2+).
| 2
KCNH1-L704A inhibits calcium(2+). 1 / 1
| 1
reach
"Strikingly, although mutations L729A and L731A in the N-terminal extended stretch of BDC2 had a small effect on in vitro complex stability (XREF_FIG, red bar), the equivalent mutation in hEAG1 (L702A and L704A) caused a clear reduction of the channel 's Ca 2+ sensitivity, less than 10% current decrease during steady-state inhibition (XREF_FIG, red bar)."
KCNH1-L702A inhibits calcium(2+). 1 / 1
| 1
reach
"Strikingly, although mutations L729A and L731A in the N-terminal extended stretch of BDC2 had a small effect on in vitro complex stability (XREF_FIG, red bar), the equivalent mutation in hEAG1 (L702A and L704A) caused a clear reduction of the channel 's Ca 2+ sensitivity, less than 10% current decrease during steady-state inhibition (XREF_FIG, red bar)."
EGF affects KCNH1
| 5
EGF inhibits KCNH1.
| 4
EGF inhibits KCNH1. 4 / 4
| 4
reach
"This Eag1 upregulation was prevented by EGF and inversely correlated with the phosphorylation of ERK1/2, suggesting that phosphorylated ERK1/2 inhibits Eag1 expression."
reach
"However, EGF did not prevent the Eag1 upregulation induced by serum deprivation."
reach
"This Eag1 upregulation was prevented by EGF and the ERK1/2 inhibitor U0126 in only lung cancer cells; vascular endothelial growth factor did not prevent Eag1 upregulation."
reach
"Nevertheless, because EGF did not prevent Eag1 upregulation in these cells, different pathways should be studied to elucidate the potential mechanisms that regulate Eag1 expression."
EGF decreases the amount of KCNH1.
| 1
EGF decreases the amount of KCNH1. 1 / 1
| 1
reach
"While EGF prevented the increase in Eag1 expression induced by serum deprivation (XREF_FIG), treatment with VEGF did not affect Eag1 expression."
| 2 3
| 2 1
sparser
"Ca(2+)/CaM is necessary to initiate binding of CaMKII to Eag but not to sustain association because binding persists when CaM is removed."
sparser
"Using coimmunoprecipitation from head extracts and in vitro binding assays, we show that CaMKII and Eag form a stable complex and that association with Eag activates CaMKII independently of CaM and autophosphorylation."
reach
"Ca (2+)/CaM is necessary to initiate binding of CaMKII to Eag but not to sustain association because binding persists when CaM is removed."
CAMK2_complex phosphorylates KCNH1.
| 1
CAMK2_complex phosphorylates KCNH1. 1 / 1
| 1
reach
"In this study, we identify a single site, threonine 787, as the major CaMKII phosphorylation site in Eag."
CAMK2_complex activates KCNH1.
| 1
| 1
reach
"It is still unknown, however, whether CaMKII and CASK and Lin -2 (the mammalian ortholog of Camguk) may also interact with and/or modulate the biophysical properties of mammalian Eag K + channels."
P38 affects KCNH1
| 1 3
P38 increases the amount of KCNH1.
| 2
P38 increases the amount of KCNH1. 2 / 2
| 2
reach
"The inhibition of p38 MAPK activation by SB203580 or siRNA reduced Eag protein level but increased p53 protein level."
reach
"P38 MAPK pathway modulates the expression of Eag in osteosarcoma cells."
P38 binds KCNH1.
| 1
| 1
sparser
"These data suggest that Eag and p38 MAPK may form a positive feedback loop to maintain the high expression of Eag in osteosarcoma cells."
P38 activates KCNH1.
| 1
P38 activates KCNH1. 1 / 1
| 1
reach
"XREF_BIBR Thus, Eag1 upregulation in response to serum deprived conditions can also be mediated by p38 activation, ROS and NOX1."
KCNH1 affects growth
| 4
KCNH1 inhibits growth. 4 / 4
| 4
sparser
"The results showed that Eag1 silencing could efficiently inhibit osteosarcoma growth."
sparser
"Our results showed that Eag1 silencing significantly inhibited osteosarcoma growth both in vivo and in vitro ."
sparser
"The data demonstrate that Eag1 silencing inhibits osteosarcoma growth in vivo ."
sparser
"Eag silencing inhibits osteosarcoma growth in vivo ."
| 4
KCNH1 inhibits cell adhesion.
| 3
reach
"Our results showed that Eag1 siRNA can inhibit OS cells adhesion, migration, and invasion through the STAT3 and VEGF pathway."
reach
"The results demonstrated that Eag1 siRNAs lead to reduced adhesion, migration, and invasion of MG-63 and Saos-2 cells."
reach
"Eag1 Knockdown Inhibits Adhesion, Migration, and Invasion of OS Cells."
KCNH1 activates cell adhesion.
| 1
| 1
reach
"Finally, we tried to explain the detailed mechanisms by which OS cell adhesion, migration, and invasion are inhibited by specific blockade of Eag1."
KCNH1 affects Sh
| 4
KCNH1 binds Sh.
| 2
| 2
reach
"An array of allele specific interaction between eag and Sh was observed, which reflects a close association between the Sh and eag subunits within the IA channel."
reach
"We have reproduced the absence of interaction between Eag and Sh reported previously within 2 days after RNA injection and with low levels of current expression (Tang, C.-Y., C. T. Schulteis, R. M. Jimenez, and D. M. Papazian."
KCNH1 inhibits Sh.
| 1
KCNH1 inhibits Sh. 1 / 1
| 1
reach
"Upon macropatch excision, rundown of the Eag current component abolished the acceleration of the Sh current decay."
KCNH1 activates Sh.
| 1
KCNH1 activates Sh. 1 / 1
| 1
reach
"We previously showed that coexpression of Sh and Eag accelerated the inactivation kinetics of the transient Sh current (Chen et al., 1996)."
| 4
| 2
reach
"By generating multiple Drosophila brain tumor models, we found that Eag channel deficiency reduces brain tumor growth and metastasis."
| 1
reach
"Mutation of Eag but not Shaker (Sh) potassium channel of the transplanted dpn overexpressing brain tumors markedly reduced tumor growth and metastasis, and extended the survival of host flies (XREF_FIG)."
| 2
reach
"For example, inhibition of the potassium channels, KCNK9 [XREF_BIBR], Kv10.1 [XREF_BIBR], hEag1 [XREF_BIBR], and HERG1 [XREF_BIBR] inhibited tumor metastasis, as did inhibition of the sodium channels, Na (v1.4) [XREF_BIBR] and Na (v) 1.5 [XREF_BIBR] and the sodium proton exchanger, NHE1 [XREF_BIBR, XREF_BIBR]."
reach
"Using multiple Drosophila brain tumor models induced by oncogene overexpression or loss of tumor suppressors to complement our study of mice with xenografted human MB cells, we show that the functions of EAG2 and Eag channel to promote malignant growth and metastasis are evolutionarily conserved (XREF_FIG)."
KCNH1 affects HIF1A
| 1 1 3
KCNH1 binds HIF1A.
| 1 1
| 1 1
reach
"This result implies that an interaction between Eag1 and HIF-1alpha might play a role in breast cancer."
sparser
"This result implies that an interaction between Eag1 and HIF-1α might play a role in breast cancer."
KCNH1 activates HIF1A.
| 1 2
KCNH1 activates HIF1A. 2 / 2
| 1 2
reach
"Eag1 expressing cells were found to induce increased HIF-1alpha activity at lower concentrations of Co 2+ (XREF_FIG)."
reach
"These results indicate that Eag1 expression induces an increase in HIF1alpha under mild hypoxia, which could reflect a shift on the threshold of the HIF-1 system."
KCNH1 affects CNBHD
| 4
KCNH1 binds CNBHD. 4 / 4
| 4
reach
"The crystal structure of eag and CNBHD complex of mEAG channel has suggested that the coupling between eag and CNBHD is involved in EAG channel gating regulated by eag domain [XREF_BIBR]."
reach
"The crystal structure of eag and CNBHD complex provides a promising approach for generating specific drugs targeting eag and CNBHD complex, the most distinct part of EAG1 channel compared to other Kv channels."
reach
"The model of CNBHD and eag complex of the hERG channel can be obtained based on the X-ray structure of the complex of the mouse EAG channel XREF_BIBR (XREF_FIG)."
reach
"However, pursuing for a specific EAG1 channel gating inhibitor by targeting the eag and CNBHD complex failed to find any high affinity leads [XREF_BIBR]."
Ica affects KCNH1
| 4
Ica inhibits KCNH1.
| 3
Ica inhibits KCNH1. 3 / 3
| 3
sparser
"Instead, we found that ICA inhibited hEAG1 in a voltage-dependent manner consistent with an enhancement of its intrinsic slow inactivation gating process."
sparser
"TEA also had no apparent effect on the rate of ICA-induced inactivation of WT hEAG1 channels ()."
sparser
"The voltage dependence of 2 µM ICA-induced inhibition of EAG1 current was half-maximal at −73 mV, 62 mV negative to the half-point for channel activation."
Ica activates KCNH1.
| 1
Ica activates KCNH1. 1 / 1
| 1
sparser
"When mutated to Leu (F359L), ICA activates hEAG1, whereas it inhibits F359L/Y464A channel currents."
CNBHD affects KCNH1
| 4
KCNH1 binds CNBHD. 4 / 4
| 4
reach
"The crystal structure of eag and CNBHD complex of mEAG channel has suggested that the coupling between eag and CNBHD is involved in EAG channel gating regulated by eag domain [XREF_BIBR]."
reach
"The crystal structure of eag and CNBHD complex provides a promising approach for generating specific drugs targeting eag and CNBHD complex, the most distinct part of EAG1 channel compared to other Kv channels."
reach
"The model of CNBHD and eag complex of the hERG channel can be obtained based on the X-ray structure of the complex of the mouse EAG channel XREF_BIBR (XREF_FIG)."
reach
"However, pursuing for a specific EAG1 channel gating inhibitor by targeting the eag and CNBHD complex failed to find any high affinity leads [XREF_BIBR]."
MiR-296-3p affects KCNH1
| 3
MiR-296-3p inhibits KCNH1.
| 1
MiR-296-3p inhibits KCNH1. 1 / 1
| 1
reach
"EAG1 was negatively regulated by miR-296-3p, and the over-expression of EAG1 at the protein level was largely correlated with a lower level of miR-296-3p in U251AR cells."
MiR-296-3p increases the amount of KCNH1.
| 1
MiR-296-3p increases the amount of KCNH1. 1 / 1
| 1
reach
"To assess whether miR-296-3p directly regulates EAG1 expression through the target site in the 3 ' UTR of EAG1, we constructed a luciferase reporter vector with the putative EAG1 3 ' UTR target site for miR-296-3p downstream of the luciferase gene (psiCHECK-2-KCNH1-3 ' UTR), and a mutant version with a deletion of the site of perfect complementarity (psiCHECK-2-mutKCNH1-3 ' UTR)."
MiR-296-3p decreases the amount of KCNH1.
| 1
Modified miR-296-3p decreases the amount of KCNH1. 1 / 1
| 1
reach
"Ectopic expression of miR-296-3p reduced EAG1 expression and suppressed cell proliferation drug resistance, and the luciferase activity of an EAG1 3 '-untranslated region based reporter construct in U251AR cells, whereas EAG1 over-expression rescued the suppressive effect of miR-296-3p in U251AR cells."
| 3
reach
"Mg 2+ slowed eag activation kinetics in a voltage dependent manner, with a larger effect after smaller depolarizing steps (XREF_FIG C)."
reach
"For instance, Mg 2+ and Ni 2+ potently block Eag channels but have little effect on the Elk channel Kv12.1, which is preferentially blocked by Zn 2+."
reach
"Eag channel pH sensitivity is attenuated by Mg 2+ but remains significant even up to 1 mM and therefore is still likely to exist in vivo."
TEA affects KCNH1
| 1 2
TEA inhibits KCNH1. 3 / 3
| 1 2
sparser
"Both TEA and 4-AP are non selective K + channel blockers capable of inhibiting Eag and HERG as well as other voltage gated K + channels."
reach
"TEA blocks ~ 50% of the hEag1 current at 80 mV when present at 7 mM in the external solution or 200 muM in the internal solution (unpublished data)."
reach
"Both K + channel blockers, 4-AP and TEA, significantly inhibited the proliferation of Eag and HERG positive SK-OV-3 cells, confirming data by Zhanping et al., on the A2780 ovarian cancer line [XREF_BIBR]."
Sh affects KCNH1
| 3
Sh binds KCNH1.
| 2
| 2
reach
"An array of allele specific interaction between eag and Sh was observed, which reflects a close association between the Sh and eag subunits within the IA channel."
reach
"We have reproduced the absence of interaction between Eag and Sh reported previously within 2 days after RNA injection and with low levels of current expression (Tang, C.-Y., C. T. Schulteis, R. M. Jimenez, and D. M. Papazian."
Sh activates KCNH1.
| 1
Sh activates KCNH1. 1 / 1
| 1
reach
"The existence of multiple eag and Sh alleles enabled an independent test of the idea of Eag as a K+ channel subunit by studying IA in different double-mutant combinations."
KCNH1 affects miR-296-3p
| 3
KCNH1 inhibits miR-296-3p.
| 2
KCNH1 inhibits miR-296-3p. 2 / 2
| 2
reach
"Subsequently, we evaluated whether ectopic expression of EAG1 could rescue the suppressive effect of miR-296-3p."
reach
"Ectopic expression of miR-296-3p reduced EAG1 expression and suppressed cell proliferation drug resistance, and the luciferase activity of an EAG1 3 '-untranslated region based reporter construct in U251AR cells, whereas EAG1 over-expression rescued the suppressive effect of miR-296-3p in U251AR cells."
KCNH1 activates miR-296-3p.
| 1
KCNH1 activates miR-296-3p. 1 / 1
| 1
reach
"Taken together, all these results strongly suggested that EAG1 is a direct target of miR-296-3p in GBM cells.To investigate the effect of EAG1 on cell proliferation, the ShEAG1 and negative vector (ShNC) were transfected into U251 and U251AR cells."
| 2 3
KCNH1 inhibits cell migration.
| 1 2
| 1 2
reach
"Furthermore, to determine whether Eag1 siRNAs inhibit cell migration and invasion by downregulating STAT3, OS cells were transfected with STAT3 siRNA."
reach
"Down-regulation of hEag1 or Orai1 reduced Ca (2+) influx and cell migration with similar efficiency."
KCNH1 activates cell migration.
| 1 1
| 1 1
reach
"In high invasive BC cells Kv10.1 modulates cell migration in regulating calcium entry through Orai1 channel 15."
| 3
| 2
reach
"In addition, silencing BKCa or hEag1 channels significantly reduced adipogenic differentiation with decrease of lipid accumulation and expression of the adipocyte marker PPARgamma, and decreased osteogenic differentiation with reduction of mineral precipitation and osteocalcin."
reach
"Like the patterns obtained by PFGE after digestion with Sma I, the Eag I-restriction patterns of DNAs from the strains examined in this study allowed the differentiation of the two Bartonella spp."
| 1
reach
"In addition, silencing BKCa or hEag1 channels significantly reduced adipogenic differentiation with decrease of lipid accumulation and expression of the adipocyte marker PPARgamma, and decreased osteogenic differentiation with reduction of mineral precipitation and osteocalcin."
KCNH1 affects cell cycle
| 1 3
KCNH1 activates cell cycle.
| 2
| 2
reach
"Eag1 Silencing Inhibits Cell Cycle Progression of Liposarcoma Cells."
reach
"To analyze how Eag1 modulates OS cell proliferation and cell cycle progression, it is important to note that Eag1 contributes to tumor progression independently of its primary function as an ion channel."
KCNH1 inhibits cell cycle.
| 1 1
| 1 1
reach
"These results indicate that selective inhibition of Eag1 expression causes G1-S cell cycle progression of cultured MG-63 cells."
KCNH1 affects astemizole
| 3
KCNH1 inhibits astemizole.
| 2
| 2
reach
"Our observation that both imipramine and astemizole block Eag channels by occlusion of the permeation pathway, which most likely entails no major allosteric changes, argues that ion permeation through the channels is affecting cell cycle."
reach
"Imipramine and Astemizole Block hEag1 Channels in their Charged Form."
KCNH1 binds astemizole.
| 1
reach
"Taken together, all results are consistent with the idea that both imipramine and astemizole bind to hEag1 channels in their charged forms from the intracellular side."
KCNH1 affects STAT3-VEGF
| 3
KCNH1 inhibits STAT3-VEGF. 3 / 3
| 3
reach
"In addition, to further evaluate whether Eag1 suppresses cell proliferation and migration by downregulating STAT3-VEGF pathway, cells were transfected with STAT3 siRNA."
reach
"Conclusions : Eag1 may promote osteosarcoma cell proliferation and invasion by targeting STAT3-VEGF pathway and may be a potential therapeutic target for osteosarcoma."
reach
"Our data indicated that Eag1 promotes osteosarcoma proliferation and migration, at least in part, by targeting STAT3-VEGF pathway."
KCNH1 affects KCN
| 1 2
KCNH1 increases the amount of KCN.
| 1
KCNH1 increases the amount of KCN. 1 / 1
| 1
reach
"The Eag1 and Eag2, voltage dependent potassium channels, and the small-conductance calcium activated potassium channel (Kcnn3) are highly expressed in limbic regions of the brain, where their function is still unknown."
KCNH1 binds KCN.
| 1
| 1
sparser
"Also studies by de Oliveira and colleagues in 2012 showed that eag potassium channel expression in the rat hippocampus has been associated with neural cell survival and transient brain ischemia [ xref ]."
KCNH1 activates KCN.
| 1
KCNH1 activates KCN. 1 / 1
| 1
reach
"This is demonstrated by experiments using MCF-7 breast cancer cells, in which application of the selective inhibitor E4031 has identified a distinct role for hERG in volume regulation that is separate from the proliferation mediated by the closely related human ether-a-go-go gene (hEAG) potassium channel 9."
KCNH1 affects ERG
| 3
| 2
sparser
"Our observations are consistent with the notion that both the N-terminal and the C-terminal recognition domains are required to sustain the subfamily-specific assembly of rat Eag1 and human Erg."
sparser
"The subfamily-specific assembly of Eag and Erg K+ channels is determined by both the amino and the carboxyl recognition domains."
ELK1 binds ERG and KCNH1. 1 / 1
| 1
sparser
"Homology screening identified that the Eag channels family was formed by Eag, Erg (the eag-related gene) and Elk (the eag-like gene) subfamily."
KCNH1 affects Cyclin
| 1 3
KCNH1 activates Cyclin.
| 2
KCNH1 activates Cyclin. 2 / 2
| 2
reach
"Moreover, the effect of hEag1 channel inhibition is accompanied by a decrease of cyclin E expression, the key regulator of the G1/S transition and necessary for the entry of cells into S phase.Astemizole treatment produced a significant decrease of cyclin D1 after 6 h."
reach
"In addition, selective inhibition of Eag1 significantly decreased the expression levels of cyclin D1 and E. Taken together, our data suggest that the Eag1 channel plays a crucial role in regulating the proliferation and cell cycle of osteosarcoma cells, and represents a new and effective therapeutic target for osteosarcoma."
KCNH1 inhibits Cyclin.
| 1 1
KCNH1 inhibits Cyclin. 1 / 1
| 1 1
reach
"Therefore, this strong decrease of cyclin D1 after 6 h of astemizole treatment is likely due to the inhibition of cyclin D1 synthesis induced by hEag1 blockage."
| 2 1
sparser
"Ca(2+)/CaM is necessary to initiate binding of CaMKII to Eag but not to sustain association because binding persists when CaM is removed."
sparser
"Using coimmunoprecipitation from head extracts and in vitro binding assays, we show that CaMKII and Eag form a stable complex and that association with Eag activates CaMKII independently of CaM and autophosphorylation."
reach
"Ca (2+)/CaM is necessary to initiate binding of CaMKII to Eag but not to sustain association because binding persists when CaM is removed."
KCNH1 affects BLNK
| 3
| 3
sparser
"Insight into the molecular interaction between the cyclic nucleotide-binding homology domain and the eag domain of the hERG channel."
sparser
"Direct interaction of eag domains and cyclic nucleotide-binding homology domains regulate deactivation gating in hERG channels."
sparser
"Calmodulin Regulates Human Ether à Go-Go 1 (hEAG1) Potassium Channels through Interactions of the Eag Domain with the Cyclic Nucleotide Binding Homology Domain."
ERG affects KCNH1
| 3
| 2
sparser
"Our observations are consistent with the notion that both the N-terminal and the C-terminal recognition domains are required to sustain the subfamily-specific assembly of rat Eag1 and human Erg."
sparser
"The subfamily-specific assembly of Eag and Erg K+ channels is determined by both the amino and the carboxyl recognition domains."
ELK1 binds ERG and KCNH1. 1 / 1
| 1
sparser
"Homology screening identified that the Eag channels family was formed by Eag, Erg (the eag-related gene) and Elk (the eag-like gene) subfamily."
Collagen affects KCNH1
| 2 1
Collagen binds KCNH1.
| 2
| 1
sparser
"We found that collagen 1 coating is associated with an increase in Kv10.1 and Orai1 channels expression and activity, and basal Ca 2+ entry."
| 1
sparser
"Furthermore, treatment of cells with MβCD, which leads to cholesterol depletion and disruption of lipid raft microdomains, decreased collagen-induced interaction between SPCA2 and Kv10.1 or Orai1."
Collagen activates KCNH1.
| 1
| 1
reach
"Collagen 1 elicits an increase of Kv10.1 activation that enhances basal Ca 2+ influx through Orai1, triggering ERK1/2 activation and promoting cell survival."
CCNA2 affects E2F1, and KCNH1
| 3
CCNA2 binds E2F1 and KCNH1. 3 / 3
| 3
sparser
"As soon as mitosis was completed and the cells re-entered the cell cycle (12 h), E2F1 binding to either Kv10.1 or Cyclin A2 promoters was dramatically diminished."
sparser
"As the cells passed through the G1/S border and S phase (0 h and 4 h respectively), binding of E2F1 to Kv10.1 and cyclin A2 promoters was less prominent."
sparser
"We found that E2F1 interacts with both Kv10.1 and Cyclin A2 promoters in a cell-cycle dependent manner ( xref )."
BLNK affects KCNH1
| 3
| 3
sparser
"Insight into the molecular interaction between the cyclic nucleotide-binding homology domain and the eag domain of the hERG channel."
sparser
"Direct interaction of eag domains and cyclic nucleotide-binding homology domains regulate deactivation gating in hERG channels."
sparser
"Calmodulin Regulates Human Ether à Go-Go 1 (hEAG1) Potassium Channels through Interactions of the Eag Domain with the Cyclic Nucleotide Binding Homology Domain."
XthA affects KCNH1
| 2
XthA activates KCNH1. 2 / 2
| 2
reach
"This plasmid was digested with Eag I and then briefly treated with ExonucleaseIII to remove the Bam HI and Sac I sites in the pBlueScript polylinker."
reach
"This plasmid was digested with Eag I and then briefly treated with ExonucleaseIII to remove the Bam HI and Sac I sites in the pBlueScript polylinker."
MiR-34 affects KCNH1
| 2
MiR-34 inhibits KCNH1.
| 1
MiR-34 inhibits KCNH1. 1 / 1
| 1
reach
"First, miR-34 directly represses h-eag1 protein."
MiR-34 activates KCNH1.
| 1
MiR-34 activates KCNH1. 1 / 1
| 1
reach
"This low expression of miR-34 may partially underlie the high abundance of eag1 in brain XREF_BIBR."
2 |
Transcriptionally active hsa-miR-7843-5p decreases the amount of KCNH1. 2 / 2
2 |
biopax:mirtarbase
No evidence text available
biopax:mirtarbase
No evidence text available
2 |
Transcriptionally active hsa-miR-7704 decreases the amount of KCNH1. 2 / 2
2 |
biopax:mirtarbase
No evidence text available
biopax:mirtarbase
No evidence text available
2 |
Transcriptionally active hsa-miR-6890-5p decreases the amount of KCNH1. 2 / 2
2 |
biopax:mirtarbase
No evidence text available
biopax:mirtarbase
No evidence text available
2 |
Transcriptionally active hsa-miR-6879-5p decreases the amount of KCNH1. 2 / 2
2 |
biopax:mirtarbase
No evidence text available
biopax:mirtarbase
No evidence text available
2 |
Transcriptionally active hsa-miR-6753-5p decreases the amount of KCNH1. 2 / 2
2 |
biopax:mirtarbase
No evidence text available
biopax:mirtarbase
No evidence text available
2 |
Transcriptionally active hsa-miR-6735-5p decreases the amount of KCNH1. 2 / 2
2 |
biopax:mirtarbase
No evidence text available
biopax:mirtarbase
No evidence text available
2 |
Transcriptionally active hsa-miR-615-5p decreases the amount of KCNH1. 2 / 2
2 |
biopax:mirtarbase
No evidence text available
biopax:mirtarbase
No evidence text available
2 |
Transcriptionally active hsa-miR-4632-5p decreases the amount of KCNH1. 2 / 2
2 |
biopax:mirtarbase
No evidence text available
biopax:mirtarbase
No evidence text available
2 |
Transcriptionally active hsa-miR-4436b-3p decreases the amount of KCNH1. 2 / 2
2 |
biopax:mirtarbase
No evidence text available
biopax:mirtarbase
No evidence text available
2 |
Transcriptionally active hsa-miR-4257 decreases the amount of KCNH1. 2 / 2
2 |
biopax:mirtarbase
No evidence text available
biopax:mirtarbase
No evidence text available
2 |
Transcriptionally active hsa-miR-2467-3p decreases the amount of KCNH1. 2 / 2
2 |
biopax:mirtarbase
No evidence text available
biopax:mirtarbase
No evidence text available
2 |
Transcriptionally active hsa-miR-1911-3p decreases the amount of KCNH1. 2 / 2
2 |
biopax:mirtarbase
No evidence text available
biopax:mirtarbase
No evidence text available
Collinein-1 affects KCNH1
| 2
Collinein-1 inhibits KCNH1.
| 1
| 1
reach
"Among 12 voltage gated ion channels tested, collinein-1 selectively inhibited hEAG1 currents, with a mechanism independent of its enzymatic activity."
Collinein-1 decreases the amount of KCNH1.
| 1
Collinein-1 decreases the amount of KCNH1. 1 / 1
| 1
reach
"Corroboratively, we demonstrated that collinein-1 reduced the viability of human breast cancer cell line MCF7 (high expression of hEAG1), but does not affect the liver carcinoma and the non tumorigenic epithelial breast cell lines (HepG2 and MCF10A, respectively), which present low expression of hEAG1."
Cisplatin affects KCNH1
| 2
Cisplatin inhibits KCNH1.
| 1
| 1
reach
"We demonstrate that decreased expression of Eag1 correlates with favorable prognosis in patients treated with cisplatin based adjuvant chemotherapy and predicts higher cisplatin sensitivity in ovarian cancer cells."
Cisplatin activates KCNH1.
| 1
| 1
reach
"However, the relationship of Eag1 expression with the clinical outcome of patients having ovarian cancer treated with cisplatin based adjuvant chemotherapy is still unknown."
VDR affects KCNH1
| 2
VDR inhibits KCNH1.
| 1
VDR inhibits KCNH1. 1 / 1
| 1
reach
"Among more than fifty K + channel subtypes, the voltage gated K + channel, ether a go-go 1 (EAG1) K + channel has a negative VDRE in its promoter and is down-regulated by a VDR dependent pathway in human cervical cancer cells [XREF_BIBR, XREF_BIBR]."
VDR activates KCNH1.
| 1
VDR activates KCNH1. 1 / 1
| 1
reach
"These studies highlight the potential therapeutic effect of calcitriol in VDR positive tumors that overexpress Eag1."
TNF affects KCNH1
| 2
TNF inhibits KCNH1. 2 / 2
| 2
sparser
"Analysis of several satellite cell regulators revealed that TNFα is capable of inhibiting Notch-1 in satellite cells and C2C12 myoblasts, which was also found to be dependent on NF-κB. Notch-1 inhibition occurred at the mRNA level suggesting a transcriptional repression mechanism."
sparser
"Analysis of several satellite cell regulators revealed that TNFalpha is capable of inhibiting Notch-1 in satellite cells and C2C12 myoblasts, which was also found to be dependent on NF-kappaB."
SRC affects KCNH1
| 2
SRC inhibits KCNH1. 2 / 2
| 2
reach
"We found that the selective epidermal growth factor receptor (EGFR) kinase inhibitor AG556 (10 muM), but not the platelet growth factor receptor (PDGFR) kinase inhibitor AG1295 (10 muM) or the Src family inhibitor PP2 (10 muM), can inhibit hEAG1 current, and the inhibitory effect can be reversed by the protein tyrosine phosphatase (PTP) inhibitor orthovanadate."
reach
"These results suggest that the EGFR kinase inhibitor AG556, but not PDGFR kinase inhibitor AG1295 or the Src family kinase inhibitor PP2, inhibits hEAG1 current in HEK cells stably expressing hEAG1 gene.To exclude the possibility that the decrease of hEAG1 current by AG556 was mediated by a direct channel block, the PTP inhibitor orthovanadate was employed to examine whether the inhibitory effect of AG556 on hEAG1 current is through EGFR kinase inhibition."
S100B affects KCNH1
| 1 1 1
| 1 1 1
reach
"Protein pull-down assays and fluorescence correlation spectroscopy (FCS) revealed that S100B binds to hEAG1 and shares the same binding sites with CaM."
sparser
"Protein pull-down assays and fluorescence correlation spectroscopy (FCS) revealed that S100B binds to hEAG1 and shares the same binding sites with CaM."
RB1 affects KCNH1
| 2
RB1 inhibits KCNH1. 2 / 2
| 2
reach
"RB1 transfection down-regulated Eag1 mRNA and protein expression."
reach
"RB1 transfection down-regulated Eag1 mRNA and protein expression."
PPP2 affects KCNH1
| 2
PPP2 inhibits KCNH1. 2 / 2
| 2
reach
"We found that the selective epidermal growth factor receptor (EGFR) kinase inhibitor AG556 (10 muM), but not the platelet growth factor receptor (PDGFR) kinase inhibitor AG1295 (10 muM) or the Src family inhibitor PP2 (10 muM), can inhibit hEAG1 current, and the inhibitory effect can be reversed by the protein tyrosine phosphatase (PTP) inhibitor orthovanadate."
reach
"These results suggest that the EGFR kinase inhibitor AG556, but not PDGFR kinase inhibitor AG1295 or the Src family kinase inhibitor PP2, inhibits hEAG1 current in HEK cells stably expressing hEAG1 gene.To exclude the possibility that the decrease of hEAG1 current by AG556 was mediated by a direct channel block, the PTP inhibitor orthovanadate was employed to examine whether the inhibitory effect of AG556 on hEAG1 current is through EGFR kinase inhibition."
PDGFR affects KCNH1
| 2
PDGFR inhibits KCNH1. 2 / 2
| 2
reach
"We found that the selective epidermal growth factor receptor (EGFR) kinase inhibitor AG556 (10 muM), but not the platelet growth factor receptor (PDGFR) kinase inhibitor AG1295 (10 muM) or the Src family inhibitor PP2 (10 muM), can inhibit hEAG1 current, and the inhibitory effect can be reversed by the protein tyrosine phosphatase (PTP) inhibitor orthovanadate."
reach
"These results suggest that the EGFR kinase inhibitor AG556, but not PDGFR kinase inhibitor AG1295 or the Src family kinase inhibitor PP2, inhibits hEAG1 current in HEK cells stably expressing hEAG1 gene.To exclude the possibility that the decrease of hEAG1 current by AG556 was mediated by a direct channel block, the PTP inhibitor orthovanadate was employed to examine whether the inhibitory effect of AG556 on hEAG1 current is through EGFR kinase inhibition."
| 2
reach
"We suspected that Eag might be activating an endogenous COS cell signal transduction pathway that controls cell architecture and that understanding the ability of Eag80 to hijack the COS pathway might give us insight into the function of this Eag splice form."
reach
"To investigate whether Eag1 silencing was able to inhibit intracellular signal transduction of VEGF, we first detected the expression of VEGF in MG-63 cells at different time points after Ad5-Eag1shRNA treatment."
| 2
KCNH1-Y464A inhibits isocyanic acid. 2 / 2
| 2
reach
"Y464A hEAG1 was more sensitive to the inhibitory effects of ICA but suppressed the ability of ICA to activate F359L hEAG1 channels."
reach
"Thus, we wondered if the corresponding mutation in hEAG1 (Y464A) would also prevent or impact the ability of ICA to alter hEAG1 channel gating."
KCNH1 affects current
| 2
KCNH1 inhibits current.
| 1
KCNH1 inhibits current. 1 / 1
| 1
reach
"In summary, cysteine oxidation in KCNH1 can induce current reduction by two mechanisms : oxidation in the N terminus augments a right shift in voltage dependence that is physiologically conferred by the N terminus."
KCNH1 activates current.
| 1
KCNH1 activates current. 1 / 1
| 1
reach
"Extracellular application of the thiol modifying reagent DTNB (100 muM), a hydrophilic poorly membrane permeable compound that modifies proteins based on the principle of thiol-disulfide exchange reaction, only slightly increased the KCNH1 mediated outward current (XREF_FIG)."
KCNH1 affects TMBTS
| 2
Mutated KCNH1 activates TMBTS. 1 / 1
| 1
reach
"Our findings demonstrate that KCNH1 mutations cause TMBTS and expand the mutational spectrum of KCNH1 in TMBTS."
KCNH1 activates TMBTS. 1 / 1
| 1
reach
"Thus, concordant to previous reports, our data supports the evidence that the mutated KCNH1 is a major cause of TMBTS and ZLS, while other genes can act as disease modifying roles."
| 2
sparser
"Furthermore, the positive rates of BNIP3 , KCNH1 , and ZNF382 methylation in the GC samples were more than 3-times higher than the SM and NorG samples (29% vs. 7~4%, 42% vs. 4~14%, and 69% vs. 18~23%, respectively)."
sparser
"Furthermore, the positive rates of BNIP3 , KCNH1 , and ZNF382 methylation in the GC samples were more than 3-times higher than the SM and NorG samples (29% vs. 7~4%, 42% vs. 4~14%, and 69% vs. 18~23%, respectively)."
KCNH1 affects STAT3
| 2 2
KCNH1 inhibits STAT3.
| 2 1
KCNH1 inhibits STAT3. 1 / 1
| 2 1
reach
"Furthermore, to determine whether Eag1 siRNAs inhibit cell migration and invasion by downregulating STAT3, OS cells were transfected with STAT3 siRNA."
KCNH1 activates STAT3.
| 1
KCNH1 activates STAT3. 1 / 1
| 1
reach
"In addition, we detected the expression of vascular endothelial growth factor (VEGF) and signal transducer and activator of transcription 3 (STAT3) in osteosarcoma cell treated with Eag1 small interfering RNAs (siRNAs)."
KCNH1 affects S100B
| 1 1 1
| 1 1 1
reach
"Protein pull-down assays and fluorescence correlation spectroscopy (FCS) revealed that S100B binds to hEAG1 and shares the same binding sites with CaM."
sparser
"Protein pull-down assays and fluorescence correlation spectroscopy (FCS) revealed that S100B binds to hEAG1 and shares the same binding sites with CaM."
KCNH1 affects IFNG
| 2
KCNH1 activates IFNG. 2 / 2
| 2
reach
"Taken together, our in vitro data suggest that while LFA-1 is not critical for EAg induced priming, polarization and expansion of IFN-gamma producing T-cells, it may be important for maximal production of IL-17A generation (XREF_FIG)."
reach
"RNA interference with EAG1 enhances interferon gamma injury to glioma cells in vitro."
KCNH1 affects Growth
| 2
KCNH1 inhibits Growth. 2 / 2
| 2
sparser
"Eag1 Silencing Inhibits Liposarcoma Growth In Vivo ."
sparser
"Eag1 Silencing Inhibits Osteosarcoma Growth in Vivo ."
KCNH1 affects FAS2
| 2
| 2
reach
"These data suggest a strong genetic interaction between fasII and beag."
reach
"We show genetic interactions between fasII and beag and find a specific reduction of both mRNA and protein levels of transmembrane isoforms of FasII in beag mutants and similar protein changes in dsmu1 mutants."
KCNH1 affects EPN
| 1 1
| 1 1
reach
"Eag1 also interacts with epsin that modulates its gating in rat brain."
sparser
"Eag1 also interacts with epsin that modulates its gating in rat brain (Piros et al., xref )."
KCNH1 affects ENO
| 2
| 2
sparser
"Based on the recursive model with a sample size of eight children, Eag was marginally associated with increases in eNO [5.6 ppb per 10-microg/m3 increase in PM2.5; 95% confidence interval (CI), -0.6 to 11.9; p = 0.08]."
sparser
"For those combined estimates, only Eag was significantly associated with an increase in eNO (Eag: 5.0 ppb per 10-microg/m3 increase in PM2.5; 95% CI, 0.3 to 9.7; p = 0.04; Eig: 3.3 ppb per 10-microg/m3 increase in PM2.5; 95% CI, -1.1 to 7.7; p = 0.15)."
KCNH1 affects CD4
| 2
KCNH1 activates CD4. 2 / 2
| 2
reach
"Taken together, our data suggest that LFA-1 is not required for EAg induced activation of CD4 + T-cells in vitro or in vivo but is required for trafficking of T-cells to the MLNs and homing of colitogenic effector cells to the colon where they initiate chronic gut inflammation."
reach
"We found that EAg pulsed dendritic cells (DCs) induced proliferation of LFA-1-deficient (CD11a -/-) CD4 + T-cells that was very similar to that induced using WT T-cells suggesting that LFA-1 is not required for activation and proliferation of T-cells in vitro."
KCN affects KCNH1
| 1 1
KCN inhibits KCNH1.
| 1
KCN inhibits KCNH1. 1 / 1
| 1
reach
"A possible role of hEag1 in leukemia cell proliferation could be shown by growth and migration inhibition of the hEag1 expressing cell lines PLB-985, K562, UT-7 and HEL and primary clinical samples by the potassium channel blockers astemizole, imipramine, the hEag1 specific monoclonal antibody mAb56 and siRNA knockdown [XREF_BIBR]."
KCN binds KCNH1.
| 1
| 1
sparser
"Also studies by de Oliveira and colleagues in 2012 showed that eag potassium channel expression in the rat hippocampus has been associated with neural cell survival and transient brain ischemia [ xref ]."
INS affects KCNH1
| 1 1
INS inhibits KCNH1.
| 1
INS inhibits KCNH1. 1 / 1
| 1
sparser
"Inactivation and tyrosine dephosphorylation of GSK-3 induced by extracellular signals It has been reported that insulin inactivates GSK-3 in CHO-IR cells and L6 myoblasts [20,22,23,26]."
INS activates KCNH1.
| 1
INS activates KCNH1. 1 / 1
| 1
reach
"PI3K mediates the ability of insulin growth factor to activate the Eag channel, and the ability of serum to activate the intermediate-conductance Ca 2+ -activated K + channel in breast carcinoma and lymphoma cells, respectively XREF_BIBR, XREF_BIBR."
IGF1 affects KCNH1
| 2 2
IGF1 increases the amount of KCNH1.
| 2 1
IGF1 increases the amount of KCNH1. 1 / 1
| 2 1
reach
"Moreover, IGF-1 increased mRNA expression of hEAG in a time dependent manner in parallel with an enhancement of cell proliferation."
IGF1 activates KCNH1.
| 1
IGF1 activates KCNH1. 1 / 1
| 1
reach
"We also demonstrated that IGF-1 increased both the activity and expression of hEag1 channels through a PI3-Kinase and Akt dependent pathway [23]."
ICI-182,780 affects KCNH1
| 2
ICI-182,780 increases the amount of KCNH1.
| 1
ICI-182,780 increases the amount of KCNH1. 1 / 1
| 1
reach
"Furthermore, the demonstration of a significant inhibition of EAG1 gene expression by ICI-182,780 in calcitriol treated cells, suggested that the antiproliferative effects of these compounds involve a number of regulatory mechanisms which are under the control of ERalpha activation."
ICI-182,780 decreases the amount of KCNH1.
| 1
ICI-182,780 decreases the amount of KCNH1. 1 / 1
| 1
reach
"Furthermore, the demonstration of a significant inhibition of EAG1 gene expression by ICI-182,780 in calcitriol treated cells, suggested that the antiproliferative effects of these compounds involve a number of regulatory mechanisms which are under the control of ERalpha activation."
HIF1A affects KCNH1
| 1 1
| 1 1
reach
"This result implies that an interaction between Eag1 and HIF-1alpha might play a role in breast cancer."
sparser
"This result implies that an interaction between Eag1 and HIF-1α might play a role in breast cancer."
FAS2 affects KCNH1
| 2
| 2
reach
"These data suggest a strong genetic interaction between fasII and beag."
reach
"We show genetic interactions between fasII and beag and find a specific reduction of both mRNA and protein levels of transmembrane isoforms of FasII in beag mutants and similar protein changes in dsmu1 mutants."
EPN affects KCNH1
| 1 1
| 1 1
reach
"Eag1 also interacts with epsin that modulates its gating in rat brain."
sparser
"Eag1 also interacts with epsin that modulates its gating in rat brain (Piros et al., xref )."
ENO affects KCNH1
| 2
| 2
sparser
"Based on the recursive model with a sample size of eight children, Eag was marginally associated with increases in eNO [5.6 ppb per 10-microg/m3 increase in PM2.5; 95% confidence interval (CI), -0.6 to 11.9; p = 0.08]."
sparser
"For those combined estimates, only Eag was significantly associated with an increase in eNO (Eag: 5.0 ppb per 10-microg/m3 increase in PM2.5; 95% CI, 0.3 to 9.7; p = 0.04; Eig: 3.3 ppb per 10-microg/m3 increase in PM2.5; 95% CI, -1.1 to 7.7; p = 0.15)."
| 1 1
reach
"According to our data, caution must nonetheless be taken when using these pleiotropic agents with widespread effects, as in addition to derepressing TSGs silenced in cancer, HDACi could activate and promote HERG1 and hEAG1 oncogenic potential."
sparser
"According to our data, caution must nonetheless be taken when using these pleiotropic agents with widespread effects, as in addition to derepressing TSGs silenced in cancer, HDACi could activate and promote HERG1 and hEAG1 oncogenic potential."
CAMK2G affects KCNH1
| 2
CAMK2G activates phosphorylated KCNH1. 2 / 2
| 2
reach
"In turn, CamKII is bound and locally activated by phosphorylated Eag (Sun et al., 2004)."
reach
"In turn, CamKII is bound and locally activated by phosphorylated Eag."
AZA1 affects KCNH1
| 2
AZA1 inhibits KCNH1. 2 / 2
| 2
reach
"At a test potential of +40 mV, AZA1 blocked hEAG1 current by 15 +/- 0.8% (n = 4)."
reach
"AZA1 did not block K + current of the closely related EAG1 channel."
AG556 affects KCNH1
| 1 2
AG556 inhibits KCNH1. 2 / 2
| 1 2
reach
"Fig. 5 shows that the modification of activation conductance and voltage dependent activation process induced by the EGFR kinase inhibitor AG556 could be significantly countered by the PTP inhibitor orthovanadate.If the hEAG1 current reduction by AG556 is mediated by EGFR kinase inhibition, tyrosine phosphorylation level of hEAG1 channel protein should be reduced by this inhibitor."
reach
"This is confirmed by the results with the immunoprecipitation and Western blot analysis : human EAG1 channel phosphorylation level was reduced by AG556, and the reduced phosphorylation is significantly countered by the PTP inhibitor orthovanadate."
| 1 1
| 1 1
sparser
"Both TEA and 4-AP are non selective K + channel blockers capable of inhibiting Eag and HERG as well as other voltage gated K + channels."
reach
"Both K + channel blockers, 4-AP and TEA, significantly inhibited the proliferation of Eag and HERG positive SK-OV-3 cells, confirming data by Zhanping et al., on the A2780 ovarian cancer line [XREF_BIBR]."
| 2
24,25-Dihydroxyvitamin D decreases the amount of KCNH1. 2 / 2
| 2
reach
"For instance, calcitriol, the active metabolite of vitamin D with known antiproliferative effects, down-regulates Eag1 expression in breast tumor derived cells and in cervical cancer [XREF_BIBR, XREF_BIBR]."
reach
"In breast and cervical cancer cell lines vitamin D inhibited the expression of the KCNH1 oncogene, encoding voltage gated channel Eag1, and that inhibition was accompanied with a reduction in cell proliferation and decreased tumor growth [XREF_BIBR, XREF_BIBR]."
| 2
reach
"Luteolin binds to EAG1 with an EC 50 of 8 microM and a Hill coefficient of 4, reflecting the binding of multiple flavonoids."
reach
"Luteolin and myricetin bound to the CNBD region and modulated gating of EAG1 channels."
Voltage-gated potassium channel affects KCNH1
| 1
KCNH1 binds voltage-gated potassium channel. 1 / 1
| 1
sparser
"Mutations in KCNH1, another member of the voltage-gated potassium channel, have also been associated with epilepsy ( xref )."
| 1
reach
"P4 induced KCNH1 mRNA and protein expression in cells transfected with human PR-B."
Sodium atom affects KCNH1
| 1
| 1
reach
"Interestingly the fraction of the electric field sensed by imipramine (39%) is similar to that reported for Na + ions, which also block Eag1 channels by an open-channel block mechanism."
Signal sequence affects KCNH1
| 1
Signal sequence activates KCNH1. 1 / 1
| 1
reach
"In vivo, the preC signal sequence targets the eAg protein into the secretory pathway."
Serotonin affects KCNH1
| 1
| 1
reach
"We thus examined if serotonin increases the hEAG1 channel activity by depleting PIP 2."
ScFv62-PhoA affects KCNH1
| 1
ScFv62-PhoA inhibits KCNH1. 1 / 1
| 1
reach
"Furthermore, pre-adsorption of scFv62-PhoA with the fusion protein containing the specific epitope used for immunization completely abolished Eag 1-IR, confirming the selectivity of scFv62-PhoA for Eag 1."
Polypeptide affects KCNH1
| 1
KCNH1 binds polypeptide. 1 / 1
| 1
sparser
"The mutation was named as the ether a-go-go gene ( eag ) and electrophysiological analysis of eag mutations in larval Drosophila neuromuscular junctions revealed larger and more prolonged synaptic potentials. xref , xref Molecular studies and subsequent expression of eag in Xenopus oocytes confirmed that eag polypeptide assembled into voltage activated K + (K V ) channels. xref , xref "
| 1
reach
"We therefore tested whether these PI lipids inhibited the hEAG1 channel."
Nwk 2 NMJs affects KCNH1
| 1
Nwk 2 NMJs inhibits KCNH1. 1 / 1
| 1
reach
"The bouton surface area in nwk 2 NMJs (17.04 +/-1.87 mum 2) was significantly decreased, < 70% of CS (29.90 +/-4.46 mum 2) or < 60% of eag 1 (25.93 +/-2.19 mum 2) (XREF_FIG)."
Nickel(2+) affects KCNH1
| 1
| 1
reach
"For instance, Mg 2+ and Ni 2+ potently block Eag channels but have little effect on the Elk channel Kv12.1, which is preferentially blocked by Zn 2+."
Myricetin affects KCNH1
| 1
| 1
reach
"Luteolin and myricetin bound to the CNBD region and modulated gating of EAG1 channels."
MiR-34a affects KCNH1
| 1
MiR-34a increases the amount of KCNH1. 1 / 1
| 1
reach
"On the other hand, the downregulation of h-eag1 expression induced by co-application of p53 activator and miR-34a was abolished by E2F1 overexpression (XREF_FIG)."
1 |
Transcriptionally active hsa-miR-7113-3p decreases the amount of KCNH1. 1 / 1
1 |
biopax:mirtarbase
No evidence text available
1 |
Transcriptionally active hsa-miR-6715b-5p decreases the amount of KCNH1. 1 / 1
1 |
biopax:mirtarbase
No evidence text available
1 |
Transcriptionally active hsa-miR-525-5p decreases the amount of KCNH1. 1 / 1
1 |
biopax:mirtarbase
No evidence text available
1 |
Transcriptionally active hsa-miR-520a-5p decreases the amount of KCNH1. 1 / 1
1 |
biopax:mirtarbase
No evidence text available
1 |
Transcriptionally active hsa-miR-508-5p decreases the amount of KCNH1. 1 / 1
1 |
biopax:mirtarbase
No evidence text available
1 |
Transcriptionally active hsa-miR-505-3p decreases the amount of KCNH1. 1 / 1
1 |
biopax:mirtarbase
No evidence text available
1 |
Transcriptionally active hsa-miR-4687-5p decreases the amount of KCNH1. 1 / 1
1 |
biopax:mirtarbase
No evidence text available
1 |
Transcriptionally active hsa-miR-4673 decreases the amount of KCNH1. 1 / 1
1 |
biopax:mirtarbase
No evidence text available
1 |
Transcriptionally active hsa-miR-4645-5p decreases the amount of KCNH1. 1 / 1
1 |
biopax:mirtarbase
No evidence text available
1 |
Transcriptionally active hsa-miR-4290 decreases the amount of KCNH1. 1 / 1
1 |
biopax:mirtarbase
No evidence text available
1 |
Transcriptionally active hsa-miR-4269 decreases the amount of KCNH1. 1 / 1
1 |
biopax:mirtarbase
No evidence text available
1 |
Transcriptionally active hsa-miR-34a-5p decreases the amount of KCNH1. 1 / 1
1 |
biopax:mirtarbase
No evidence text available
1 |
Transcriptionally active hsa-miR-339-5p decreases the amount of KCNH1. 1 / 1
1 |
biopax:mirtarbase
No evidence text available
1 |
Transcriptionally active hsa-miR-335-5p decreases the amount of KCNH1. 1 / 1
1 |
biopax:mirtarbase
No evidence text available
1 |
Transcriptionally active hsa-miR-296-3p decreases the amount of KCNH1. 1 / 1
1 |
biopax:mirtarbase
No evidence text available
1 |
Transcriptionally active hsa-miR-1233-3p decreases the amount of KCNH1. 1 / 1
1 |
biopax:mirtarbase
No evidence text available
Haloperidol affects KCNH1
| 1
| 1
reach
"Clofilium, E4031, and haloperidol apparently inhibited hEAG1 channels with lower potency than hERG1 channels, but they can not be considered hERG1 specific."
| 1
reach
"We found that the selective epidermal growth factor receptor (EGFR) kinase inhibitor AG556 (10 muM), but not the platelet growth factor receptor (PDGFR) kinase inhibitor AG1295 (10 muM) or the Src family inhibitor PP2 (10 muM), can inhibit hEAG1 current, and the inhibitory effect can be reversed by the protein tyrosine phosphatase (PTP) inhibitor orthovanadate."
Fluoride affects KCNH1
| 1
reach
"CADcarboxyl assembly domain CaMcalmodulin Cetncentrin CNBHDcyclic nucleotide binding homology domain DMSOdimethyl sulfoxide Eag ether-a-go-go GFPgreen fluorescent protein GSTglutathione S-transferase HEKhuman embryonic kidney PMSFphenylmethylsulfonyl fluoride PSDpostsynaptic density rEagrat Eag SPMsynaptosomal The ether-a-go-go potassium (K +) channel family, a member of the voltage gated K + (Kv) channel superfamily, comprises three subfamilies : Eag (Kv10), Erg (Kv11), and Elk (Kv12) 1."
Dronedarone affects KCNH1
| 1
| 1
reach
"Also, we show that, while amiodarone inhibits the Cole-Moore shift, dronedarone is unable to inhibit this voltage dependent characteristic of Kv10.1."
Dofetilide affects KCNH1
| 1
| 1
reach
"Different relevance of inactivation and F468 residue in the mechanisms of hEag1 channel blockage by astemizole, imipramine and dofetilide."
DnaE coding sequence affects KCNH1
| 1
DnaE coding sequence activates KCNH1. 1 / 1
| 1
reach
"The Ef dnaE gene was amplified by PCR using 5 ' -TAATT CGGCCG CAT ATG TCA TTT CCA CAA TTG CAT ACC GTT ACT as the upstream primer (italicized sequences, start of the putative dnaE coding sequence; underlined sequences, adjacent Eag I and Nde I sites) and 5 ' -AAAAA GGATCC CGCAAAAATTGATATACAAAAATATTACGTCATTCATT as the downstream primer (italicized sequences, Ef genomic DNA beginning 123 bases downstream of the 3 ' end of dnaE; underlined sequence, Bam HI site)."
DiC8-PIP 2 affects KCNH1
| 1
DiC8-PIP 2 inhibits KCNH1. 1 / 1
| 1
reach
"In contrast, diC8-PIP 2 (3 muM), which failed to inhibit the hEAG1 channel in our electrophysiological experiments (XREF_FIG), also failed to elicit any noticeable BLI signal (XREF_FIG)."
| 1
sparser
"Intracellular application of H 2 O 2 or cysteine-specific modifiers potently inhibited KCNH1 channels in two phases."
C-fos promoter affects KCNH1
| 1
KCNH1 binds c-fos promoter. 1 / 1
| 1
reach
"An Eag I- Bsp HI fragment of pBI-EGFP containing the coding sequence of EGFP and its SV40 polyadenylation signal or a Sac II- Nae I fragment of pTRE-d2EGFP containing the coding sequence of d2EGFP and its SV40 polyadenylation signal were blunt-end ligated into the c-fos promoter plasmids in place of the c-fos coding sequence between the Nae I and Hin dIII sites."
Barium(2+) affects KCNH1
| 1
| 1
reach
"Ba 2+ ions extracellularly applied at a concentration of 1 mM inhibited hEAG1 channels to 24 +/-8% of the control current, while hEAG2 currents were only reduced to 71 +/-7% (n = 5, P = 0.025)."
Amiodarone affects KCNH1
| 1
| 1
reach
"Additionally, and interestingly, we also report that amiodarone inhibits the characteristic Cole-Moore shift of Eag1 channels."
Agarose affects KCNH1
| 1
| 1
reach
"In double restrictions agarose blocks containing Eag I digested chromosomes were incubated in 10 mM EDTA and washed in TE before being digested with Sma I as described above."
WDYHV1 affects KCNH1
1 |
1 |
biogrid
No evidence text available
VEGF affects KCNH1
| 1
VEGF inhibits KCNH1. 1 / 1
| 1
reach
"This Eag1 upregulation was prevented by EGF and the ERK1/2 inhibitor U0126 in only lung cancer cells; vascular endothelial growth factor did not prevent Eag1 upregulation."
UBA2 affects KCNH1
| 1
| 1
sparser
"Here, we first describe the application of this novel label-free technique to study the interaction of human EAG1 (hEAG1) channel proteins with the small molecule PIP2."
U0126 affects KCNH1
| 1
U0126 inhibits KCNH1. 1 / 1
| 1
reach
"This Eag1 upregulation was prevented by EGF and the ERK1/2 inhibitor U0126 in only lung cancer cells; vascular endothelial growth factor did not prevent Eag1 upregulation."
TOR1A affects KCNH1
| 1
TOR1A activates KCNH1. 1 / 1
| 1
reach
"Brain metastases patients showing a low Kv10.1 expression and treated with TA showed in our investigation a significantly longer overall survival compared to patients without TA therapy."
SHP-1 mutant affects KCNH1
| 1
SHP-1 mutant inhibits KCNH1. 1 / 1
| 1
reach
"Both hERG and hEAG1 currents were decreased by applying active recombinant SHP-1, and increased by the inhibitory substrate trapping SHP-1 mutant."
SHBG affects KCNH1
| 1
| 1
reach
"Sensitivity analysis confirmed that the association between nighttime SBP (00:00 -04:00) and eAG was independent of carotid intima-media thickness in the African men (R (2) = 0.617; beta = 0.438; p = 0.008)."
SHB affects KCNH1
| 1
| 1
reach
"If the interaction of Eag and ShB shown here were mediated by coassembly of the subunits, this would be the first case of heteromultimeric assembly of different K + families (cf. Covarrubias et al., 1991)."
SH affects KCNH1
| 1
| 1
sparser
"An array of allele-specific interaction between eag and Sh was observed, which reflects a close association between the Sh and eag subunits within the IA channel."
SDCBP affects KCNH1
1 |
1 |
biogrid
No evidence text available
SAP affects KCNH1
| 1
KCNH1 binds SAP. 1 / 1
| 1
sparser
"PagR, and not AtxA itself, is the direct effector of this regulation by binding to sap and eag promoter regions."
Rg3 affects KCNH1
| 1
Rg3 activates KCNH1. 1 / 1
| 1
reach
"Rg3 also induced slowing of ERG1, ERG3, and ELK1 channel deactivation and accelerated the rate of EAG1 channel activation."
| 1
reach
"XREF_BIBR Thus, Eag1 upregulation in response to serum deprived conditions can also be mediated by p38 activation, ROS and NOX1."
RPS6 affects KCNH1
| 1
RPS6 activates KCNH1. 1 / 1
| 1
reach
"The mutation Y464A in the S6 segment also induced inactivation of EAG1, with a time course and voltage dependence similar to that caused by 2 microM ICA."
RABEP1 affects KCNH1
| 1
RABEP1 activates KCNH1. 1 / 1
| 1
reach
"Moreover, knockdown of rabaptin-5 reduces recycling rates of Eag1 and leads to a reduction of Eag1 current-density."
Phosphatase affects KCNH1
| 1
| 1
reach
"The hEAG1 current is modulated by SHP-1 tyrosine phosphatase."
PPY affects KCNH1
| 1
PPY inhibits KCNH1. 1 / 1
| 1
reach
"External pH has previously been reported to slow activation and reduce Mg 2+ sensitivity in rat Eag1."
NUP214 affects KCNH1
| 1
| 1
reach
"We show that loss of function caused by disruption of this domain in Herg1 can be rescued by introducing the equivalent domain from Eag1, and that this chimeric protein can form heteromultimers with Eag1 while wild-type Erg1 can not."
NOX1 affects KCNH1
| 1
NOX1 activates KCNH1. 1 / 1
| 1
reach
"XREF_BIBR Thus, Eag1 upregulation in response to serum deprived conditions can also be mediated by p38 activation, ROS and NOX1."
NK cell-TRAIL affects KCNH1
| 1
NK cell-TRAIL inhibits KCNH1. 1 / 1
| 1
reach
"In keeping with these data, a recent study has shown that NK cell-TRAIL blockade may also lead to recovery of HBV specific T cells in eAg negative patients virally suppressed on NUCs [XREF_BIBR]."
NH affects KCNH1
| 1
NH bound to calcium/calmodulin inhibits KCNH1. 1 / 1
| 1
reach
"Concurrent binding of calcium/calmodulin (Ca 2+ / CaM) to NH 2 - and COOH-terminal sites inhibits mammalian EAG1 channels at submicromolar Ca 2+ concentrations, likely by causing pore constriction."
MUC7 affects KCNH1
| 1
MUC7 activates KCNH1. 1 / 1
| 1
reach
"Intracellular linkers are involved in Mg2 +-dependent modulation of the Eag potassium channel."
KCNH1 affects voltage-gated potassium channel
| 1
KCNH1 binds voltage-gated potassium channel. 1 / 1
| 1
sparser
"Mutations in KCNH1, another member of the voltage-gated potassium channel, have also been associated with epilepsy ( xref )."
KCNH1 affects voltage-gated potassium channel
| 1
KCNH1 activates voltage-gated potassium channel. 1 / 1
| 1
reach
"Eag1 Expression Interferes with Hypoxia Homeostasis and Induces Angiogenesis in Tumors * S. Ether-a-go-go-1 (Eag1) is a CNS localized voltage gated potassium channel that is found ectopically expressed in a majority of extracranial solid tumors."
| 1
reach
"In addition, we detected the expression of vascular endothelial growth factor (VEGF) and signal transducer and activator of transcription 3 (STAT3) in osteosarcoma cell treated with Eag1 small interfering RNAs (siRNAs)."
KCNH1 affects spoIVB gene product
| 1
KCNH1 activates spoIVB gene product. 1 / 1
| 1
reach
"EaG then directs production of the spoIVB gene product [80], which acts back across the septum in some manner to activate the processing of pro- in the mother cell [81]."
KCNH1 affects pyraclofos
| 1
| 1
reach
"Although the amino (N)-terminal region such as the eag domain is not required for the C-type inactivation of Erg channels, an N-terminal deletion in mouse Eag1 has been shown to produce a voltage dependent inactivation."
KCNH1 affects polypeptide
| 1
KCNH1 binds polypeptide. 1 / 1
| 1
sparser
"The mutation was named as the ether a-go-go gene ( eag ) and electrophysiological analysis of eag mutations in larval Drosophila neuromuscular junctions revealed larger and more prolonged synaptic potentials. xref , xref Molecular studies and subsequent expression of eag in Xenopus oocytes confirmed that eag polypeptide assembled into voltage activated K + (K V ) channels. xref , xref "
| 1
sparser
"To test whether PIP 2 directly interacts with the hEAG1 channel, we used bio-layer interferometry (BLI) to measure the kinetics of binding of PIP 2 to the purified hEAG1 channel complex."
| 1
reach
"The most dramatic effect of all kcnh1 directed MO injections was a dose dependent mortality of early embryos."
KCNH1 affects mRNA
| 1
KCNH1 inhibits mRNA. 1 / 1
| 1
reach
"Eag1 targeted siRNAs decreased Eag1 mRNA and protein expression, which resulted in decreased growth in the majority of cell types investigated."
| 1
| 1
reach
"With respect to the fluid-phase uptake of K V 10.1-BBS detected, it is tempting to ask whether interactions of K V 10.1 with the filament system might modulate channel activity and localization XREF_BIBR, XREF_BIBR, along with surface expression."
KCNH1 affects imipramine
| 1
reach
"Imipramine Binding to hEag1."
KCNH1 affects hypoxia-inducible factor
| 1
Modified KCNH1 increases the amount of hypoxia-inducible factor. 1 / 1
| 1
reach
"Moreover, Eag1 expression increases basal expression levels of hypoxia inducible factor 1alpha (HIF1alpha), resulting in the upregulation of VEGF [XREF_BIBR]."
KCNH1 affects hexadecane
| 1
| 1
reach
"Eag1 Expression Interferes with Hypoxia Homeostasis and Induces Angiogenesis in Tumors * S. Ether-a-go-go-1 (Eag1) is a CNS localized voltage gated potassium channel that is found ectopically expressed in a majority of extracranial solid tumors."
KCNH1 affects fluoride
| 1
reach
"CADcarboxyl assembly domain CaMcalmodulin Cetncentrin CNBHDcyclic nucleotide binding homology domain DMSOdimethyl sulfoxide Eag ether-a-go-go GFPgreen fluorescent protein GSTglutathione S-transferase HEKhuman embryonic kidney PMSFphenylmethylsulfonyl fluoride PSDpostsynaptic density rEagrat Eag SPMsynaptosomal The ether-a-go-go potassium (K +) channel family, a member of the voltage gated K + (Kv) channel superfamily, comprises three subfamilies : Eag (Kv10), Erg (Kv11), and Elk (Kv12) 1."
KCNH1 affects cell death
| 1
| 1
reach
"The involvement of Eag1 potassium channels and miR-34a in rotenone induced death of dopaminergic SH-SY5Y cells."
KCNH1 affects c-fos promoter
| 1
KCNH1 binds c-fos promoter. 1 / 1
| 1
reach
"An Eag I- Bsp HI fragment of pBI-EGFP containing the coding sequence of EGFP and its SV40 polyadenylation signal or a Sac II- Nae I fragment of pTRE-d2EGFP containing the coding sequence of d2EGFP and its SV40 polyadenylation signal were blunt-end ligated into the c-fos promoter plasmids in place of the c-fos coding sequence between the Nae I and Hin dIII sites."
KCNH1 affects activation
| 1
KCNH1 inhibits activation. 1 / 1
| 1
sparser
"Figure xref D-E showed that Kv10.1 and Orai1 silencing inhibited the ERK1/2 activation in MCF-7 and T-47D cells (Figure xref , N=3, p <0.05)."
KCNH1 affects ZLS
| 1
KCNH1 activates ZLS. 1 / 1
| 1
reach
"Thus, concordant to previous reports, our data supports the evidence that the mutated KCNH1 is a major cause of TMBTS and ZLS, while other genes can act as disease modifying roles."
KCNH1 affects WDYHV1
1 |
1 |
biogrid
No evidence text available
KCNH1 affects VEGF/PI3K/AKT
| 1
KCNH1 activates VEGF/PI3K/AKT. 1 / 1
| 1
reach
"Eag1 Silencing Inhibits VEGF/PI3K/AKT Signaling in Osteosarcoma Cells."
KCNH1 affects UBA2
| 1
| 1
sparser
"Here, we first describe the application of this novel label-free technique to study the interaction of human EAG1 (hEAG1) channel proteins with the small molecule PIP2."
KCNH1 affects TP53
| 1
KCNH1 activates TP53. 1 / 1
| 1
reach
"Eag1 silencing by antisense oligonucleotides reduced the growth stimulation effect of E2F1 and, in addition, abrogated the effects of p53 inactivation."
KCNH1 affects Signaling
| 1
KCNH1 inhibits Signaling. 1 / 1
| 1
sparser
"Eag1 Silencing Inhibits VEGF/PI3K/AKT Signaling in Osteosarcoma Cells."
KCNH1 affects SHBG
| 1
| 1
reach
"Sensitivity analysis confirmed that the association between nighttime SBP (00:00 -04:00) and eAG was independent of carotid intima-media thickness in the African men (R (2) = 0.617; beta = 0.438; p = 0.008)."
KCNH1 affects SHB
| 1
| 1
reach
"If the interaction of Eag and ShB shown here were mediated by coassembly of the subunits, this would be the first case of heteromultimeric assembly of different K + families (cf. Covarrubias et al., 1991)."
KCNH1 affects SH
| 1
| 1
sparser
"An array of allele-specific interaction between eag and Sh was observed, which reflects a close association between the Sh and eag subunits within the IA channel."
KCNH1 affects SEZ6L2
| 1
KCNH1 activates SEZ6L2. 1 / 1
| 1
reach
"pGAD424 and hnRNP L (24-558), pGAD424 and hnRNP L (141-558), and pGAD424 and hnRNP L (294-558) were constructed by inserting DNA fragments of pSK and hnRNP L treated with Eag I-Klenow- Pst I, Hin cII- Pst I, and Kpn I-T4 polymerase- Pst I, respectively, into the pGAD424 vector treated with Bam HI-Klenow- Pst I. pGAD424 and hnRNP L (24-291) and pGAD424 and hnRNP L (24-140) were constructed by inserting DNA fragments of pSK and hnRNP L treated with Kpn I-T4 polymerase- Eag I and Eag I- Hin cII, respectively, into the pGAD424 and hnRNP L (24-558) vector treated with Pst I-T4 polymerase- Eag I. To construct pGAD424 and hnRNP L (141-291), pGAD424 vector treated with Bam HI-Klenow was ligated with pSK and hnRNP L treated with Kpn I-T4 polymerase- Hin cII."
KCNH1 affects SDCBP
1 |
1 |
biogrid
No evidence text available
KCNH1 affects SAP
| 1
KCNH1 binds SAP. 1 / 1
| 1
sparser
"PagR, and not AtxA itself, is the direct effector of this regulation by binding to sap and eag promoter regions."
KCNH1 affects PRKACG
| 1
KCNH1 activates PRKACG. 1 / 1
| 1
sparser
"Drosophila olfactory neurons usually display background firing in the absence of odorants, cAMP dependent eag activation might provide an OR based mechanism of homeostatic plasticity in the periphery of the olfactory system, and could adjust the neurons to a desired output range."
KCNH1 affects PPY
| 1
KCNH1 activates PPY. 1 / 1
| 1
reach
"We suggest that Eag and Elk channels could contribute to a neuronal pH sensitive K + current characterized as either a voltage dependent or leak conductance."
KCNH1 affects NUP214
| 1
| 1
reach
"We show that loss of function caused by disruption of this domain in Herg1 can be rescued by introducing the equivalent domain from Eag1, and that this chimeric protein can form heteromultimers with Eag1 while wild-type Erg1 can not."
KCNH1 affects NFIX
| 1
KCNH1 activates NFIX. 1 / 1
| 1
sparser
"Now elegant in vitro and in vivo studies demonstrate that that the transcription Nfix is expressed in fetal and not embryonic myoblasts, and Pax7 directly binds and activates the expression Nfix ( xref )."
KCNH1 affects MMUT
| 1
KCNH1 activates MMUT. 1 / 1
| 1
reach
"Eag I digestion produces four partial cleavage sites in the Mut A DM, in addition to the complete cleavage site at the landmark CpG island (Beland et al., 1993)."
KCNH1 affects LQT2
| 1
Mutated KCNH1 activates LQT2. 1 / 1
| 1
reach
"LQT1 and LQT2 are caused by missense mutations of the KCNH1 and KCNH2 gene, respectively."
KCNH1 affects ITGAL
| 1
KCNH1 activates ITGAL. 1 / 1
| 1
reach
"It could be argued that while EAg induced activation of CD11a -/- deficient T-cells is virtually identical to WT T-cells, cytokine production may be very different."
KCNH1 affects HNRNPL
| 1
KCNH1 activates HNRNPL. 1 / 1
| 1
reach
"pGAD424 and hnRNP L (24-558), pGAD424 and hnRNP L (141-558), and pGAD424 and hnRNP L (294-558) were constructed by inserting DNA fragments of pSK and hnRNP L treated with Eag I-Klenow- Pst I, Hin cII- Pst I, and Kpn I-T4 polymerase- Pst I, respectively, into the pGAD424 vector treated with Bam HI-Klenow- Pst I. pGAD424 and hnRNP L (24-291) and pGAD424 and hnRNP L (24-140) were constructed by inserting DNA fragments of pSK and hnRNP L treated with Kpn I-T4 polymerase- Eag I and Eag I- Hin cII, respectively, into the pGAD424 and hnRNP L (24-558) vector treated with Pst I-T4 polymerase- Eag I. To construct pGAD424 and hnRNP L (141-291), pGAD424 vector treated with Bam HI-Klenow was ligated with pSK and hnRNP L treated with Kpn I-T4 polymerase- Hin cII."
KCNH1 affects HACD1
| 1
| 1
sparser
"Ca 2+ -CaM-dependent Inhibition of hEAG1 Required Interactions between the PAS-cap and cNBHD."
KCNH1 affects GOPC
| 1
| 1
sparser
"Here we describe a PDZ domain-mediated interaction of KV10.1 and PIST, which enhances surface levels of KV10.1."
KCNH1 affects FPG family
| 1
sparser
"Surprisingly, the eAG levels were closely associated with the FPG levels when the measurements were taken the same day."
KCNH1 affects FLNB
| 1
| 1
reach
"Tissue samples from animals derived from (AUG X BN.1 C) F1 X AUG and (AUG X BN.1 C) F1 X BN.1 C backcrosses were examined and a linkage association between Eag-1 and Fh-1 (EC 4.2.2.1) was detected."
KCNH1 affects FASTKD5
1 |
1 |
biogrid
No evidence text available
KCNH1 affects ESR1
| 1
| 1
sparser
"Real-time RT-PCR experiments in HeLa cells showed that Eag1 estrogenic regulation was strongly associated with the expression of estrogen receptor-alpha."
KCNH1 affects EC
| 1
KCNH1 binds EC. 1 / 1
| 1
sparser
"Luteolin binds to EAG1 with an EC 50 of 8 µM and a Hill coefficient of 4, reflecting the binding of multiple flavonoids."
KCNH1 affects EAG
| 1
KCNH1 activates EAG. 1 / 1
| 1
reach
"Electroantennogram (EAG) responses of maleRhopobota naevana (Hubner), the blackheaded fireworm, to all of the monoene straightchain 12- and 14-carbon alcohols and acetates implicated (Z)-11-tetradecenl-1-ol (Z11-14 : OH) and its acetate (Z11-14 : Ac) as sex pheromone components.Z11-14 : Ac produced the strongest EAG response of all compounds tested."
KCNH1 affects DM
| 1
KCNH1 activates DM. 1 / 1
| 1
reach
"Eag I digestion produces four partial cleavage sites in the Mut A DM, in addition to the complete cleavage site at the landmark CpG island (Beland et al., 1993)."
| 1
| 1
reach
"Additionally, inhibiting Eag1 with the vector or astemizole (5 microM) reduced glioblastoma cell viability and sensitized cells to TMZ."
KCNH1 affects CaMKII mutant
| 1
KCNH1 binds CaMKII mutant. 1 / 1
| 1
reach
"The Eag CaMKII binding domain has homology to the CaMKII autoregulatory region, and the constitutively active CaMKII mutant, T287D, binds Eag Ca (2+)-independently in vitro and in vivo."
KCNH1 affects CHN1
| 1
| 1
sparser
"This study by xref establishes that the hERG channel has an N–C domain–domain interaction between the eag domain and the C-terminal domain, providing a basis for addressing many intriguing questions."
KCNH1 affects CDKN1A
| 1
KCNH1 activates CDKN1A. 1 / 1
| 1
reach
"In addition, it has been reported that silencing hEag1 (K V 10.1) in cells led to a decrease in cyclin expression and an increase of p21 [XREF_BIBR]."
KCNH1 affects CALM1
1 |
1 |
biogrid
No evidence text available
KCNH1 affects Asp-Asp
| 1
KCNH1 activates Asp-Asp. 1 / 1
| 1
reach
"Nevertheless, both eag and Shab, like Sh (133), increased DD spike generation and recovery time from GF pathway failure."
KCNH1 affects Angiogenesis
| 1
KCNH1 inhibits Angiogenesis. 1 / 1
| 1
sparser
"Eag1 Silencing Inhibits Angiogenesis of Xenografted Osteosarcoma."
KCNH1 affects ALG10
1 |
1 |
hprd
No evidence text available
KCNH1 affects AKT
| 1
KCNH1 activates AKT. 1 / 1
| 1
sparser
"These results indicate that the ephrinA/EphA signal, but not the ephrinB/EphB signal, downregulates the IGF-I–induced ERK1/2 cascade without affecting the AKT activation by IGF-I in C2C12 and L6 myoblasts."
| 1
reach
"Luteolin binds to EAG1 with an EC 50 of 8 microM and a Hill coefficient of 4, reflecting the binding of multiple flavonoids."
| 1
reach
"The deficiency of EAG1 only caused a mild hyperactivity and longer lasting haloperidol induced catalepsy but did not affect amphetamine sensitization and withdrawal and the reactivity to apomorphine and haloperidol in the prepulse inhibition (PPI) tests or to antidepressants in the haloperidol induced catalepsy [XREF_BIBR]."
HACD1 affects KCNH1
| 1
| 1
sparser
"Ca 2+ -CaM-dependent Inhibition of hEAG1 Required Interactions between the PAS-cap and cNBHD."
GPCR affects KCNH1
| 1
GPCR activates KCNH1. 1 / 1
| 1
reach
"However, the magnitude of hEAG1 current increase in vivo mediated by GPCR activation is difficult to predict."
GOPC affects KCNH1
| 1
| 1
sparser
"Here we describe a PDZ domain-mediated interaction of KV10.1 and PIST, which enhances surface levels of KV10.1."
F_actin affects KCNH1
| 1
F_actin activates KCNH1. 1 / 1
| 1
reach
"We found that disruption of F-actin or microtubules reduced the number of Eag1 channels inside synaptic terminals as assessed by colocalization of Eag1 with the presynaptic marker synaptophysin (Mander coefficients = 0.25 +/-0.01, n = 19, 0.19 +/-0.01, n = 18 and 0.16 +/-0.01, n = 16 for DMSO, Latrunculin A and Nocodazole, respectively; one-way ANOVA followed by Bonferroni 's multiple comparison test, * p < 0.05, *** p < 0.001; XREF_FIG)."
FPG family affects KCNH1
| 1
sparser
"Surprisingly, the eAG levels were closely associated with the FPG levels when the measurements were taken the same day."
FOXH1 affects KCNH1
| 1
FOXH1 activates KCNH1. 1 / 1
| 1
sparser
"ICA at 2 µM did not affect the rate of fast activation of hEAG1 ( xref , squares)."
FLNB affects KCNH1
| 1
| 1
reach
"Tissue samples from animals derived from (AUG X BN.1 C) F1 X AUG and (AUG X BN.1 C) F1 X BN.1 C backcrosses were examined and a linkage association between Eag-1 and Fh-1 (EC 4.2.2.1) was detected."
FASTKD5 affects KCNH1
1 |
1 |
biogrid
No evidence text available
ERK1/2 inhibitor affects KCNH1
| 1
ERK1/2 inhibitor activates KCNH1. 1 / 1
| 1
reach
"This Eag1 upregulation was prevented by EGF and the ERK1/2 inhibitor U0126 in only lung cancer cells; vascular endothelial growth factor did not prevent Eag1 upregulation."
ERK affects KCNH1
| 1
ERK phosphorylates KCNH1. 1 / 1
| 1
sparser
"Interestingly, the DDR1 (a potential target of collagen 1) knockdown induced a decrease in ERK1/2 phosphorylation and expression of both Kv10.1 and Orai1, and consequently an increase in apoptosis."
ENAH affects KCNH1, KCNK2, OBSCN, PTPRC, RGS1, S100A3, and TNR
| 1
sparser
"1q21.1–q44 contains OBSCN , PTPRC , TNR , KCNK2 , S100A3 , ENAH , RGS1 and KCNH1 genes, which were associated with progression of cancer."
ELK1 affects ERG, and KCNH1
| 1
ELK1 binds ERG and KCNH1. 1 / 1
| 1
sparser
"Homology screening identified that the Eag channels family was formed by Eag, Erg (the eag-related gene) and Elk (the eag-like gene) subfamily."
EGFR inhibitor affects KCNH1
| 1
EGFR inhibitor activates KCNH1. 1 / 1
| 1
reach
"In 2012, a second paper from the same group showed that only the EGFR inhibitor decreased the hEAG1 current XREF_BIBR."
EC affects KCNH1
| 1
KCNH1 binds EC. 1 / 1
| 1
sparser
"Luteolin binds to EAG1 with an EC 50 of 8 µM and a Hill coefficient of 4, reflecting the binding of multiple flavonoids."
DTNP affects KCNH1
| 1
DTNP inhibits KCNH1. 1 / 1
| 1
reach
"In contrast, extracellular application of 20 muM of DTNP, a lipophilic membrane permeable thiol modifying reagent, caused rapid and complete inhibition of macroscopic KCNH1 current (XREF_FIG)."
DTNB affects KCNH1
| 1
DTNB inhibits KCNH1. 1 / 1
| 1
reach
"The observation that DTNB decreases KCNH1 currents could be interpreted to indicate that DTNB is a simple pore blocker."
Collagen affects KCNH1, and ORAI1
| 1
| 1
sparser
"We found that collagen 1 coating is associated with an increase in Kv10.1 and Orai1 channels expression and activity, and basal Ca 2+ entry."
Cetn4 affects KCNH1
| 1
Cetn4 decreases the amount of KCNH1. 1 / 1
| 1
reach
"In other words, despite their striking difference in Ca 2+ requirement for physical association with the K + channel, both centrin 4 and CaM suppress Eag1 current level in a Ca 2+ -dependent manner."
CaMKII mutant affects KCNH1
| 1
KCNH1 binds CaMKII mutant. 1 / 1
| 1
reach
"The Eag CaMKII binding domain has homology to the CaMKII autoregulatory region, and the constitutively active CaMKII mutant, T287D, binds Eag Ca (2+)-independently in vitro and in vivo."
CYP27B1 affects KCNH1
| 1
CYP27B1 activates KCNH1. 1 / 1
| 1
reach
"CYP27B1 transfected cells produced more calcitriol and less EAG1 mRNA."
CUL7 affects KCNH1
| 1
CUL7 inhibits KCNH1. 1 / 1
| 1
reach
"Cullin 7 mediates proteasomal and lysosomal degradations of rat Eag1 potassium channels."
CTTN affects KCNH1
| 1
CTTN inhibits KCNH1. 1 / 1
| 1
reach
"Depletion of cortactin decreases the number of functional Eag1 channels without altering their open probability or conductance."
CHN1 affects KCNH1
| 1
| 1
sparser
"This study by xref establishes that the hERG channel has an N–C domain–domain interaction between the eag domain and the C-terminal domain, providing a basis for addressing many intriguing questions."
CASK affects KCNH1
| 1
CASK activates KCNH1. 1 / 1
| 1
reach
"It is still unknown, however, whether CaMKII and CASK and Lin -2 (the mammalian ortholog of Camguk) may also interact with and/or modulate the biophysical properties of mammalian Eag K + channels."
CALM1 affects KCNH1
1 |
1 |
biogrid
No evidence text available
C7-to-C61 cross-link affects KCNH1
| 1
C7-to-C61 cross-link inhibits KCNH1. 1 / 1
| 1
reach
"The C7-to-C61 cross-link has been suggested to prevent assembly of eAg into capsids (Schodel et al."
ATP2C2 affects KCNH1, and ORAI1
| 1
| 1
sparser
"As shown in Fig.  xref , MCF-7 cells, when seeded on collagen 1 coating, show an increased physical interaction of SPCA2 with both Kv10.1 and Orai1 after 48 hours of starvation."
ATP2C2 affects Collagen, KCNH1, and ORAI1
| 1
| 1
sparser
"Furthermore, treatment of cells with MβCD, which leads to cholesterol depletion and disruption of lipid raft microdomains, decreased collagen-induced interaction between SPCA2 and Kv10.1 or Orai1."
AP180 affects KCNH1
| 1
AP180 inhibits KCNH1. 1 / 1
| 1
reach
"Overexpression of AP-180, reported to block CME XREF_BIBR, slightly decreased K V 10.1 surface levels."
ALG10 affects KCNH1
1 |
1 |
hprd
No evidence text available
ABCB1 affects ABCC1, and KCNH1
| 1
| 1
sparser
"Furthermore, knockdown of Eag1 expression was associated with decreased expression of the P-glycoprotein without affecting multidrug resistance-associated protein 1 expression."
| 1
17alpha-ethynylestradiol increases the amount of KCNH1. 1 / 1
| 1
reach
"Estrogen has also been shown to increase Eag expression by its action on Estrogen receptor alpha (ERalpha) in cervical and lung carcinoma cells [XREF_BIBR]."